GenePrediction:GLEAN_7482 Details

Name: GLEAN_7482
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1826147..1825443 (- strand)
Length: 705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1826147..1826090 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_140:1826034..1825789 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_140:1825731..1825631 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:1825565..1825443 (- strand)
Length: 123
>GLEAN_7482 class=GenePrediction position=GCSC_140:1826147..1825443 (- strand)
ATGCCGCCAACATCACTCACCACTGCCTCGATTGCGGCTGTCGCAACCGGCCTTGTTGGTGAGCCATATCTCCACCTGCA
GCTTCGCTCTTCTCGACCGCTAACCCGCTGCAGCTTACGCCCTCTACTTTGACCACCGCCGACGGTCGCAGCCCGAGTTC
CGCCGGGTGCTCCGGAGAAACGAGCGGCAGCAGGCCCGGGCTGAAAAGGAGATGGCTCACAAGGAAACCGCCAAGCAGCG
CGAGGTCATCAAGCTGGCCGTCGACCTGGCCAAGGCCGAGGGCTTTCCCACCAGCGTCGAGGACAAGGAGGCCTTCTTCC
TGGACCAGGTGTCCAAGGGCGAGACTCTGGGTACTGACCGTGAGCTCAATTCATCTTCTCCGTCCCAATGCAAGATTGAT
ACTGACAGCCTCAAAGCGACCAAATCGATCGAGTCTGCCCTCCACTTCTACAAGGCCCTCAAGGTCTACCCAACGCCTGG
CGATCTGATACGCATCTATGACCAGACCGTATCCAAGGTGAGAGAGAGAATGCTTTTATTTCGCTGCTGGACGCCTGCTG
ACTCACTCTTCTTTGTTGCCAGCCCATCCTCGACATCCTCGCCGAGATGATCGCCTTCGATGCCGAGCTCAGCATCCGCG
ACATGGCCCCGCAGCCGTCTCTCGGGGTCAACGACCTATTCCCGCCACAAGCGAGCCTCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62