GenePrediction:GLEAN_7483 Details

Name: GLEAN_7483
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1819359..1818541 (- strand)
Length: 819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1819359..1819069 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_140:1818972..1818723 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_140:1818662..1818541 (- strand)
Length: 122
>GLEAN_7483 class=GenePrediction position=GCSC_140:1819359..1818541 (- strand)
ATGGCCACCAGCGTTATCTCGGCAATGCCCAACGGTCTCGTGGTGTCGTCGTCACCCCATATGGCGTGCGTCGATGATAA
GTATCGGTTCGATACCCTCATTCTGGGATTGAAGCATGCTTTGGGGCCATCATCAGGCCTGACGTCGGACGATATTGATG
TCGGACACCTCACTCGCCTGATGGAGAAGTATGATGCAAAAGAAAAGGGATGGATGCCGTACAACTTTGGCGATGCCAGT
CGTGGCTACACCCGCAACCTTGTTGATGAGGGTAATGGAAAGAGTAACCTAGTATGTCTTATTGTCTACCCTTCCTGTCT
TTAACTTCAAACGAACCACTCGGTTCGTCATTGTAGTCCGCACAAATAATAACACATCGCAACACAGCTTGTGCTCGTGT
GGTCGCCAGGCAAAGGTAGCCCGATCCATGACCATGGCAATGCCCACTGCCTCATGAAGATCTTGCACGGCAACCTCACC
GAGACGCGTTATAGATTCCCTGAAGACGGCCAGGAAGGACCCATGAATGTCACCTCTGAGAAGACATACTCGGAGAACGC
TGTCGCCTATATGGCCGACGAGCTTGGTGTTCACAGGATGTGGAACAAAGGCAGCGACTTCGCTGTGTCGCTTCATCGTG
AGTGTCTCGTCACAGGAGATATGAAGTGGATATGACAACTGACATGAACTCATGTAGTGTACACTCCACCAAACGTAGCA
AAGGGAGGCTGCAACATCTTCAATGAGAAGACGAGCAAGAGCAGCCACGTCGAGAAATGCGGATACTACACCGCGTATGG
GAAACTTCTTAAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62