GenePrediction:GLEAN_7486 Details

Name: GLEAN_7486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1806277..1805005 (- strand)
Length: 1273
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1806277..1806192 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:1806141..1805142 (- strand)
Length: 1000
Type: CDS
Source: GLEAN
Position: GCSC_140:1805085..1805005 (- strand)
Length: 81
>GLEAN_7486 class=GenePrediction position=GCSC_140:1806277..1805005 (- strand)
ATGATCGTGCCAGAGAGCGGACCGGTGCTGGCACAGCCGGCGGGGGGCGAGGGGTCGTCTGTAGACGCAGCGCCGGACGA
GTTTGAGTGAGTGACAAAAGATGCCGTTTCTATGAGCTCTGCTGACAAATCATCAGTATCGTCGCCACATACCATCGGCT
GCTCGCCGAGGACGCCGACCTGACGCGGCCCATTGCGGCCATCGAGGCGCTCATCGAGGTGCTCCGTCACACCCCGTCGT
CCACAGCCATGGAGACGTACGAGATCAGCGAGACACAGGTGCTGCGACTGCACGCTGCCGTCCCCAACTCGCTGCCCATC
GAAGCCGGAACCCGCATGTTCACCGGCTTCCTCAGCATGTCCATGCGCCAGCCGAGCGCTGCTCCCATCAACATGACCGC
CAGCACCACCAGCAGCATCGGCGGCCTCGACAGCTTCGACAAGATCCGTCAGCACCTGCTCGACAACAGCCAGCTCTTTG
TCCAGCGCGCCAAAGAGGCCCGTCACCGCATCGCTGATCGTGGCTGTCGTCTCGTCGAATCCGGCCACGTCGTCCTCACT
GCTGGTGGCTCGCGTGCCGTTCAAGCCCTTCTGCTCAAGGCCGCTGAGCGTCTGACCGCTCGCCAATCTGGACTTCCGGC
CGCCTCACCCGATGAATGGCCTTTTCCGACGGCACCCGAACCCACATCCGCCCCCTTCACCGTCCTCTATGTCGTCGACG
AACGCTCACGTCAAGAGTCTGAACGTCACATGACCGTCCTGCGCAGCCACCACATACCCGTTATTGAGATCGACCCCAGT
GCTGTCGCCTATGCCCTCGAGGCCTACGCCGTCCGCTCTGTCTTCGTCGGCGCCGAGGCTGTCACCCACGACGGCAAAGT
CGTCTCTCGCATCGGCACCTTCCAGCTTGCCGTCCTTGCTGATGCCGCCAAGCCCAAGCGCAATTTCTTCGTCCTCGTTG
AGACCCACAAGTTCGTCCGCAAACTGCTGCTCAACAACCGCGACCTCTCCCGCATCAACGTCCAGCAGGCCTTCTTCGCC
CCAGACGGCTCCTCTCCTAGACCTGTTCCTGCTCGTGTCGCCAGCCAGCCGCCCGCAAAACCCCTGCTGCCCTTCTGCAG
TCAGGTCGACGTCACCGTAAGCAACCGCCCCCTCCTGTATCCTCCTCGCCTGCTGTTTTACTGACTGTACAGCCCCCTAC
TCTCGTCACAAACTTCATCACCGAGAACGGCATAATACAGCCGTCTGGATCCTACCGCATCGTCGCCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62