GenePrediction:GLEAN_7487 Details

Name: GLEAN_7487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1798536..1797738 (- strand)
Length: 799
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1798536..1798409 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_140:1798352..1798163 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_140:1798073..1797738 (- strand)
Length: 336
>GLEAN_7487 class=GenePrediction position=GCSC_140:1798536..1797738 (- strand)
ATGGAAGAAAGGTACTCCGTACTCGTACGCCCGTTGGCAGACGCGCCCGAGTGCCTATCATCGGGATCCAGTCCTGCCGT
GCTTATGCCTGCATCTGCGGCTGTCCGAACGACATTGAAGATGATACCGTGAGCACTGTCGCCTTCGTGTGCTGATGTCA
GCCTGCTGACTAAGCACGTTCAAGATTCGATGGCGCCTCTCTTCCGCCTGCCTATGTCGAGCCCGACTACATTGGCCCCG
AGCCAGCTGGCGGCCCCGTGGGCGATGAGCCGTCCAAGATCTACCATGGCAGCTGCCACTGCGGTGCGGTGCGCATGTCT
CTGCGCTCCAAGCCGCTGGAGACTCTCGATCCGACAGGCAAGATAGGCCACATTGTTGACTGCAACTGTAGTATCTGCAT
CCGAGTAAATTCTCTCCCAAACCAACGCAAATAGGACATGATTGCATTGTTGACCTGTAGCAGGGCGGTTATATCTGGAT
CTATCCCACGAAAGACCAATCTGCCGTCCAGGGCGAAGACAATTTGACGCACTACAGCTTTGCCAATCACGTCGACCGCA
AGAGCTTCTGCCGCACTTGCGGTGTCCATCTCTTCAATATTGGCGTTGAGTACACTCTCGAAGAGGAGGCTGCGCTTCCT
GTGGTAGCCCGCTCCGAGACTGCCCGCACGGGTCGTGAAGAATGCCGCGACGAGCGAAACATCAACACCCGCGTGCTTCA
CGGCGTTGACGTGAACAAGCTTCCGGTCCATTACTTGGACGGAAACGGAGACATGGAACCACAATACGTGAACCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62