GenePrediction:GLEAN_7489 Details

Name: GLEAN_7489
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1786081..1785561 (- strand)
Length: 521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1786081..1785947 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_140:1785896..1785561 (- strand)
Length: 336
>GLEAN_7489 class=GenePrediction position=GCSC_140:1786081..1785561 (- strand)
ATGTCCAAGCGTGCCGCCGCAGGCGGCGTCGACCAGATGGTCAAGCTCATTGTGGGTGCCGGCCAGGCCAGCCCCAGCCC
GCCGGTTGGTCCGGCTCTCGGTAGCAAGGGTATCAAGTCGATGGATTTTTGCAAGGTCTGTCTACGTCTTCTTTCCCGCT
GCCGTCTTCTCCTCTGACTGTCCAGGAATTCAATGCGCGCACCGCACACATCAACCCCGGCACCCCGCTCCCCGTTCGTG
TCATTGTCCGGCCCGATCGGTCGTTCTACTTTGACGTGCGGACGCCGCACACATCCTGGCTGCTGCTGAACACGGCCGAG
GTGCCCGAGGGCAAGGGAGGCAAGCGCCGTGGTGCCCATAGCCCGGGCAAGGAGACGGTCGGCACGGTCAGCCTCAAGCA
CATCTATGAGATTGCCAAGATCAAGCAGAGCGAGCCGCGGCTGTCGGGATCCTCTCTCGAGAGCCTCTGCCGGTCCATCA
TATTCCAGGCCAAGTCGGTGGGCATTGCCGTGGTGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62