GenePrediction:GLEAN_748 Details

Name: GLEAN_748
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1861426..1861874 (+ strand)
Length: 449
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1861426..1861433 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_97:1861517..1861644 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_97:1861723..1861874 (+ strand)
Length: 152
>GLEAN_748 class=GenePrediction position=GCSC_97:1861426..1861874 (+ strand)
ATGTCTGGGTAGGTTCCGGCTGTTTCCTACCGTGGCTGAGAGCTGGCTGATGTGCTGACCCGTTTGTGTCTGTGCCGACG
CTCCGTTGCAGCGTCGAACACTCTACCTACTACGACCGTCGCCTGCGGCAGTCGCCGGCTCTGATCCGTGCCCGCCGGCC
ATACCTGGTCAAGAATACGGTCCTGGGTCTGGGCATTGTGGGGTTCACGCTGGGCGTGTGTGAGTACATTGCTGCCGGGT
GACTGTGTGGTTGCGAGCCGGTCCGCAGACCCGTCTGATCTTGACTGACCACCACAGATGCCTACACCATCCATGTCGTC
GGCCAGGACGAATTTGACGACGTCCAGGTGCCCAGCGAGCCACAGCCGTCGATCCAACAGCGCGTGCAGCAGCTGCAGCA
GCAGTCGGCCGCATTACAAGCGCCGGCACCGATAGCCGGCAAAAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62