GenePrediction:GLEAN_7491 Details

Name: GLEAN_7491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1768347..1767715 (- strand)
Length: 633
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1768347..1768158 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_140:1768087..1768027 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_140:1767950..1767930 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:1767840..1767799 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_140:1767742..1767715 (- strand)
Length: 28
>GLEAN_7491 class=GenePrediction position=GCSC_140:1768347..1767715 (- strand)
ATGGGTGTCACCAAGACTACGCACCAGGAGGGCAGTGGCCCCAGCCCAGGCGTGGGCCAGCGCGTCACTATTGAGTACAC
CGGCTTTCTGAAGGACACCTCCAAGCCTGGGAACAAGGGCAAGCAGTTCGACAGCTCTGTCGGCCGTGGCGACTTTGTCA
CCTCCATTGGTGTCGGCCAGGTCATCAAGGGTAAGAGGACAGGCGCTTTGATTGTACAATGCAGAGTTGCAATTGCAGAC
TGACCATGCTGACATTGCAGGCTGGGATGAGGGCGTTATGCAGATGAAGGTCGGCGAGAAGGCCACCCTGGACATCTCGA
GGTAACCCATTTTGCCCTTCTGACACTCCATTCTGAAAATTCCCGCAGACGCACAGAAACTGACTCTTTCCTCGCAGCGA
CTTTGGCTATGGCACACGGTAAGATTGGCACAACACCATTTTTATTTAGCCAACCCCAGAAGGAAAGGAATGGTAGGACG
GGCCACTAACAAAATTTGTGTACTTAGGGGCTTCACGGGTCACATCCCGCCCAACGCGGACCTTATCTTGTATGTATCCG
GCGCGTTCTGTCTGACTGCGACCTGCTGCTAACCCTGCATTGCAGCGATGTCCACCTGAAGAAGATCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62