GenePrediction:GLEAN_7492 Details

Name: GLEAN_7492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1766454..1763127 (- strand)
Length: 3328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1766454..1766449 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_140:1766362..1765983 (- strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_140:1765897..1763911 (- strand)
Length: 1987
Type: CDS
Source: GLEAN
Position: GCSC_140:1763855..1763127 (- strand)
Length: 729
>GLEAN_7492 class=GenePrediction position=GCSC_140:1766454..1763127 (- strand)
ATGGGGGTAAGCTTCCAGCCCTGACTTCTCTCCCCGGTTGATGATGACCTAGTAGTTTTGGGCCGAGGCAAACTGACGCT
CGCTTTATCCAGGACACAAAGCTACCCGAAGTCGACCTGGTCACCCGGATGCAGGTCGATGAGTCTGTCGTCGTCGGCAA
CGACGGCATCGACGAGTCGCTCTACAGCCGCCAACTCTACGTACTCGGCCATGACGCCATGAAACGGATGAGCGCATCTA
ACGTTCTTATCGTCGGACTCAAGGGACTCGGTGTTGAGATCGCCAAAAACATCGCTCTTGCTGGAGTCAAGAGTCTCACG
CTCTATGACCCTGCCCCTGTCGCGATTGCGGACCTTTCCTCCCAATTCTTCCTCCGGCCTGAAGACGTCGGCAATCCTCG
CGACAAGGTTACCGCTCCCCGCGTCGCTGAGCTCAACGCCTACACTCCCGTTACCATCCACGACTCTGCGAGGTGCGTAA
TACGGCTGGATATTGCTGTGTGTTGAATGCTGGCGTGGATTTATGAGACAAAGAGACTGACTTCTCCTCGACGACAGCCT
CGCCGAGAACCTGTCACAATTTGACAAGTTCCAAGTCGTTGTCCTGACCAACACCCCTCTCAATATCCAGATTGCCGTGG
GCGATTACTGCCACGAGAAGGGCATCTATGTTATTGTCGCGGACACCTTTGGCCTGTTTGGTACCCTTTTTTGCGACTTC
GGCTCCAAGTTCACTGTCGTCGACTCTACCGGCGAGAACCCTCTCAATGGCATTGTGGCAGACATCGACGATGATGGCCT
TGTGTCAGCCCTCGACGAAACGCGCCATGGCTTAGAGGATGGTGATTACGTGACATTTTCCGAAGTCGAGGGTTTGGAAG
CGCTCAACGGCGGCGAGCCAAGGAAGATCACGGTCAAAGGCCCATACACATTCTCCATTGGTGATGTTAGCACATTGGGC
AAGTACAAGAGCGGAGGCCTTTACCAGCAGGTCAAGATGCCCAAGCACATCGACTTCCAGAGCATCTCGGCCGCTATCAA
AACCCCGGAGTTTATTATGACCGACTTTGCCAAGTTTGATCGTCCGCAGCAGCTGCACATCGGCTTTCAGGCACTCCACG
CTTTTGTTCAGACCCACAACCGCCTGCCGCGACCTTGCAATGCCGAGGATGCCACCGTTGTGGTCAGCTCGGCACGCAGC
TTCGCCCAGCAGGAGGGAATTGATGTCGAGATTGACGAGAAGCTCTTGACTGAGCTTAGCTACCAGGCGATGGGGGATCT
CAACCCCATCGCTGCCTTTTTCGGCGGCATTATCGCGCAAGAGGTGCTAAAGGCTGTTTCGGGCAAGTTCCACCCGATTA
AGCAATGGCTGTACTTTGACTCTCTTGAGTCTCTGCCCAGCAACTTTGAGCGATCCGAGGAGCTGTGCAAGCCGCTGGGT
TCACGCTACGACGGTCAGATTGCCGTATTCGGTCGTCCGTTTCAGGAGAAGCTGTCCAACATCAAGCAGTTCCTTGTCGG
TGCTGGTGCCATCGGTTGTGAGATGCTGAAGAACTGGGCTATGATCGGCCTTGGTTCTGGTCCGAAGGGAAAGATCATTG
TCACGGACATGGACTCTATCGAGAAGAGCAACCTCAATCGACAGTTCTTGTTTAGGCCAAAGGACGTGGGCCAGATGAAG
AGCGACACGGCAGCCAAGGCAGTGCAGTTGATGAACCCAGACCTGGTGGGTCACATCGAGTGTCTTCGTGAGCGTGTGAG
CCCCGAGACAGAGGAAATTTTTGGCGAAAGCTTCTGGGAGGGCCTAGATGGTGTAACCAACGCCCTGGACAATGTTGAGG
CACGTACCTACGTTGACCGGCGGTGCGTGCTGTTCCGCAAGCCACTTCTCGAGAGCGGCACTCTGGGGACCAAGGGCAAC
ACACAAGTGGTGCTGCCGAACATAACCGAATCCTACTCGTGGTCGCAGGATCCGCCTGAGCAGTCGTTCCCCATGTGCAC
GTTGCGCAGTTTCCCGAACAAGATCGAGCACACTATCGCCTGGGCGCGCGAGATGTTCGATACCAACTTCGTCAAGACGG
CCGAGACAGTCAACCTGTATTTGACGCAGCCCAATTACATTGAGACAACTCTCAAGCAGTCGGGCAACGAAGTGGGCACG
CTGGAGACGCTGCGCGACTATCTCAAGACCGATCGGGCACTCACTTTTGAGGACTGCGTCAGCTGGGCGCGTATGCTCTT
TGAAAAGCAATACAACAATGCCATTCAACAGCTGCTGTACACCTTTCCCAAGGACTCCGTCTCGTCGACTGGCACACCGT
TCTGGTCCGGCCCGAAGCGAGCTCCCGATCCGATCAGGTTTGACCCTTCCAACCCGACGCACTACACCTTTATTGTTGCC
GCCGCAAACCTACATGCTTTCAACTACAACATAAATGTGCAGGGCAAGAGCAAGACCGACTACCTTTCTGCGCTGGACAA
CGTTATCGTTCCCAATTTTTCGCCCGACCCAAGTGTTAAGATTCAGGCTGACGACAAGGACCCGGTACGTGGCAACCGAC
ACAGAGACACAATCAGAACAAGAGCTGACAATCCTACAGGATCCGAACGCAGGCGCATTTGACGATGAGACCTACCTAAA
GAGGCTTGTTGAGTCACTCCCGGCGCCGAGCTCACTGGCCGGCTTCAAGCTGGCGCCTGTCGAGTTTGAGAAGGACGACG
ACACGAACTTTCACATTGACTTTATCACGGCTGCCAGCAATCTGAGAGCGGAGAACTACAAGATTGAGACAGCAGACCGG
CACAAGACCAAATTCATTGCGGGTAAGATCATTCCGGCCATTGCGACGACGACGGCACTTGTTACGGGACTGGTGATCTT
GGAGCTGTACAAGGTCGTGGATGGAAAGACGGACATTGAGCAGTACAAGAACGGATTCATCAACCTGGCTCTGCCGCTTT
TCACCTTTAGCGAGCCAATCAACAGCCCTAAGATGGAGTACCAGGGCCCGGATGGCAAGGTCAAGCTGGACAAGATCTGG
GATCGGTTCGAGCTTCCGGATGTAACTTTGCAGGAGCTGCTCGACGACTTCGAGAAGCGTGGCCTGACCATCTCAATGCT
GAGCTCGGGAGTCAGCCTGCTGTACGCGTCATTTTTTCCACCGGCCAAGCTCAAGGACCGGTACGGTATGAAGCTGAGTA
AGCTGGTAGAGACGATCTCGAAGAAGCCGATCCCGGAGCACCAGAAGGAGGTTATTTTCGAGGTGGTGGCCGAAGACATC
AACGAAGAGGACGTGGAAGTACCTTACATCAAGGTCAAGGTCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62