GenePrediction:GLEAN_7493 Details

Name: GLEAN_7493
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1762446..1760928 (- strand)
Length: 1519
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1762446..1762270 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_140:1762180..1762001 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_140:1761937..1761850 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:1761764..1761250 (- strand)
Length: 515
Type: CDS
Source: GLEAN
Position: GCSC_140:1761185..1760928 (- strand)
Length: 258
>GLEAN_7493 class=GenePrediction position=GCSC_140:1762446..1760928 (- strand)
ATGCACCTCGTCGCTGTCCGTCCTGCAATTGCCCACACCCGCATCAGCAGCATCGTCATCGCCCTCTGCAGCCCCACTGC
GAGAGAACCGAGCCAAAGAAGCTTCCACAGCAGTACCCTCTCCAGCTTCCGTTACTCTGCCGTCCGCCAAGCGGCCTGGA
ACTCTCCAGCCAAAATGGTGAGATGATGTTCTTCCATGGCGCCGTGATGTCTGTGGTTTCGTGTCCCGACCGGCAGCTCA
CCAGTCCCTCTTTCCCGTCTTTCTAGGCAGCCCGGAGCTTCAAGATCACAGACTGGGTCGACCCCAAGGACAAGTCGGGC
GAGTTTAAGCGCCAGACGAGCTCGTTCCGCGACTGGATCGGCCGTCCGTCCGAGGAGGGCGGTGCAGTTCAGTTTCCGGT
CGAGAAGGATCGGTACCACCTCTACGTCAGCACGGCATGTCCCTGGGTAAGGCATCCTTCTCTCTAGATCTCTCCGTCTC
ATCGACGTCTGCTGACGGAAAGCACGCAGGCCACCCGCACGCTGATCGCCCGCAAGCTCAAAGGCCTAGAAGACATTGTC
TCCGTCACGGTTGTGCACTGGAAGCTTGCCGAAGGTGGTGAGTAGAGTCTTCGGGCCGAGCTTCTCTCCCTTCAATCGTT
ATATCCCCCTCCTCATTCTTCTTCTGACTGCCATACCCCCAGGCTGGCGGTTTGCCACGGCAGAAGACCAAGACGCCCCT
GGCGAGCACGTCGAGCCCGACCCAGTCCCGGGCCACGAGGATTTCACCCATCTTCGCCAGGTGTACATTGAGTCGGCCGA
GGACTATACCGGCCGCGTGACCGTCCCGGTGCTCTACGACAAGAAGCAGAAGCGCGTGGTCAACAACGAGAGCAGCGAGA
TCCTACGCATCTTCAACAGCGCCTTTAACGACCTGCTGGAGCCCAAGTACAGGAACATTGACCTCTATCCTGAGGCTCTC
CACAGCGAGATCGAGGCCGCCAACGCGTGGCAGTATGACAACATCAACAACGGCGTCTACAAGAGCGGCTTTGCCACGAC
CCAGGCGGCCTACGAGCGCAACGTCGTCCTCGTCTTCGACGCCCTGGACCGCGCCGAAAAGCATCTGGCCGGAAATACCG
CCAACGGGCCATACTGGTTCGGCAAGACCATGACCGAAGTTGACATCCGGCTGTTTGCTACCATCGTCCGCTTCGACGTG
AGACTTCCGTTTTCCTGGCTTGCCATCGCTTTGTCATCTGCTTACTAATCAAACTCTCCAGCCCGTCTATGTCCAACACT
TCAAATGCAACTTGGCCGACATCCGCTCCGGTTACCCGCACCTGCACAAGTGGATGCGCAACCTGTACTGGAACGTGTCC
GCCTTCAAGGACTCGACCGACTTCTTGCACATCAAGAGCCACTACACTAAGAGTCACACCCAGATCAATCCCTTCAGCAT
TACGCCCTTGGGCCCGAAGCCGGATATCTTCCCGTTGGACGAAGAGGTGCCTGCCGTCAAGGCCTCTGGAAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62