GenePrediction:GLEAN_7494 Details

Name: GLEAN_7494
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1750965..1745467 (- strand)
Length: 5499
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1750965..1746926 (- strand)
Length: 4040
Type: CDS
Source: GLEAN
Position: GCSC_140:1746865..1745467 (- strand)
Length: 1399
>GLEAN_7494 class=GenePrediction position=GCSC_140:1750965..1745467 (- strand)
ATGGCCGGCAACCACATGTCCATGTACTCCATGAACTCGGAGTCCATGGGGCCTCGTGGTGCTGGGCAGCAATCTTCCCA
GGTCTCAACGACAACACTACTTAACGCTATTCACAACATCTACCTCTCATCCACGCCGTACCTTCTCGATGCCGGTACCA
GCGTCGTCGTCAACACCTGGCTGACCGCCTCCCAGTCGGGTCACAGCGGACAACCTGGCGGGACTGTCGATGGCTCGCTC
GCCTTACGGGCTTGGGAACATGCCCGGCGTCGTGCCGAGGACGGTTGCATCATCTTGACATCTCTCCACACGTCATCTCC
ATCACTTCTCGCACCCTTCCTGTCCACCCTTCCGCTTTCACTCCCCACGTCTCTGTTCAAATCTCTCGAAGCCCTGCAGC
CGTTCATACGCTGTGTCACGCCATACAATCCGTCAACACCCCGACAGACTGCTCTCGGTGTGACACTGACCCTCAACCTT
GCCGGCAACTTGACAGCAGCCTCTCTGGCTCTCTCCCAGGGCGGCATCGACACCATCAAGGGCCTCCTAAATGTTCCCGC
AGAGGCAGGTTATCGTGCCTTCGACGTGTTCTATTATCTGCTCACGTCAGCTTCCACACCGGCCGAGAGAGAATTTCTTG
GCCTGAAGGCAGCTCCAGCCTACTCGCTCCTTGCCCGTTCAGGCAACTACGGACCTCCTTCGTACCTGCCAACGGCTGAC
GATGCAGCAGCTGCTGATGACTTCCGTGCTGCCTTGAAAGAGATCGGCATCAAGGGCTCTGCTCACCGCAACCTCATCTC
CATCCTGGCTGGCCTTTTAAAGCTGGGAAACACACTCGACTACGACGTTGATGGCGACGTGCTAGAGGAGGTTTGCGAAG
ATGTCAGCGGGCTGCTTGGTGTGGAGCCAGAGGTCCTGGTTCGCGGCTGCTCTACCGAGGATCGCAGAACATTCATCGGC
GCCTTGTATGAGGCCCTGGTCGATTGGGTTATCTCCAAGGCAAACACGGCCATTTCTGCACAGATGAGTCGTACGCGAGA
TGCCGATGACTCGAGCGAAAGCGCCGGCGGTGTCCACACACCCAACACGGACGACAACGGAGACACGGTTTGCATCACAG
TTCTCGAGATTCCGGATCCCATGCTGGGTAAGGCGATCTCTATGCGCAGTGTCTTTGACGATACCACCGGCATCAACTCG
GAGATGAAGGAGGATGGCGTTGACGTGACGGCTGCCGGCAGCTCTGTGCTGCGTGAGATGGAGAACGCCGTGAGCGAGGT
CGGGCCTGACCTAGGCATCATGAGCGGCCCGGCTGGTCGGGAGCGCAGCCATCTGCTTGAGAAGCGCGAAGAGCTGCTCG
AGAAATTGTCCCACGCTTCTGACGCAGATGGCTTTCTCAAGAGCCTTTTAGTTCCCGTGGAGGGAGAAGGCGTCAATCTC
GGCCGCGCAGGCCGTCTGGACCTCGCAAACATGCTTCTCACCAACCGCGTTTGGTACCATCTCTGCATCCACCCCACTGA
CGACTCCCCGGCCAACATTGCAGCCTTGCCTTCGGTGAACTCGGCGTGGTCTGCCGGCACCGTGTCACGCCAGTTACGTG
CGTGGCGTCTGCCAGAATGGGCCAATCGGCGCAACAAGAATTTAGACTTCACGGCCGACTTTGACCATGACGAGTTCGTC
CAGCGCTACGCCCCTCTGGGCTGCCGGGACGGTCGTGACGGAATCGAGAGCTGGGTACTGGAGCGCGGATGGAGCAACGG
CGAGGTGGTCGTTGGTACCGAGCGCATCTGGATGCGCGAGAGCGCCTGGTGGGATGCCGAAAGCATGCTGGATCTGAAGC
CGGAAGCAGGCATGCCATCCAGCGGTAGTTTCGGCAACTCGCTTGGTGTTCCAGGCATGGAGTCGGGATATGCCGCCAAC
AACGGCAGCGGTTTCTTCCCACAGCAGCCATATATGGGCGAGGGTGCCGCAAGCGGCAGCCGGGATCAACTGCTAGACCA
CCAGCGAAACATGAGCCAGGGCACGCTTGGGTTTGCGCAAAATCCAATGGCTGGTGCTCATGGCATGCCTGGCGGTATAG
CACCGTCTGTCATGGGCGGTAGCGCTGTAGGCGGAGACAGCAAACGCAACAGCAAGAACGTCTTTAAGGGCGACTATGGT
TTGGGCACCAAGGGTGACGACATGAACAAGTTCTACTACAACAACGATGGCGAGTTCATCGGCCTGGACGCGGAACTCAC
TGAAGGCAAGGAGATCACGTCGCAGCCGATCTCAACTAGCCGCCGTGTCTGGGTGACCGTTGTGTGGACCTTGACTTTTT
GGATTCCGTCACCGCTGCTGCGCTATGTTGGTCGGATGAAGCGGCCGGATGTGCGCATGGCATGGCGGGAGAAGTTTGTG
CTTTGTGCCATCATCGCCCTGATCAATGCAATCGTCGTGTTCTGGATTGTCGCATTTGGACGGCTGCTCTGCCCGAACTA
CTCCAAGGCCTGGACGGAGACGCAGCTGGCTACGCATCAAGGCAACTACGACTTCTGGGTCGGCATCCACGGCAAGGTAT
ACGACATATCCAAGTTTTGGCGCGTCCAGCACAGTGATATCACAGCGCGTGAAGTGACTTCGGCGCTCATGACACCCCTG
TCCGGCCTCGTTCTCGACCAGTACTTTGCGCCCCCTCTGACCTTGTCCTGCCAAGGACTGGTGACGGATGAGACGCTGTA
TCTCCAGTTCAACGCGACTGACGACAATCCGGAAGCCGACCACACGTCTGGCTCTCGACAGGCTGTAACGAGCAGTGCGC
TCTACAGCGACACATGGTACACGGATGTGTTTCTACCCAAGATCGAGCAGTACTATCACGGTGACATTGTGTGGAGCAAG
AACAAGATCAAGAACGAGGGAATAGAACAAAACCACGAATGGGTCATATACGATGGATTGGTCTACGATTTAGGCAACTA
CTTCTACACCCTGTCGATGATGGATGATTTGGCAACGTACAAATTCCTCAACTCCGACCTGACCGACGCCGTGGAAAGCG
CCCCGGGTACTGATATCACCTCAACGTGGAACACGCTCATCAAGAAGGCGCAAAACAACGCGACGGAATTGGCGAGCATC
ACCAACAGTATCACGTGCATCAAGAACAACTTCTATGTTGGCAAGCCCGACTTCCGGTATAGTGCACGGTGCCAGGTGAA
CGGGTACATTTTGCTCGCCTTCACTGTCCTTCTGTGTATTGTGATTCTGGTCAAGTTCCTGTCTGCCCTGCAGTTTGGCT
CAAAGCGGCGGCCGTCTCCGCAAGACAAATTTGTCATCTGCCAGGTGCCGGCCTACACGGAAGGCGAGGACTCGCTCCGC
ACGTCGCTCGATTCTCTCACCGCGCTGCAGTATGACAACAAGCGAAAGCTGATCTGCGTTATCTGTGACGGCGTCATTGT
TGGCGCTGGCAACGACCGCCCGACGCCCAAGATCGTCCTCGACATTCTGGGTGTTGATCCCAAGGTAGACCCACCTGCAC
TGCCCTTCAAATCTGTGGGCACCGGCAGTGAGCAGCTGAACTACGGCAAGGTGTACTCGGGTCTCTACGAGTTTGAGGGC
AACGTTGTGCCGTATCTTGTCATCGTCAAGGTCGGCAAGGAGTCGGAGAAGGCCAAGACCAAGCCCGGCAACCGTGGTAA
GCGAGACTCGCAGATTTTGGTCATGAGCTTCCTGAATCGCGTCCACCACCGTGCGCCGATGAACCCGCTGGAGCTGGAAA
TCTTCCACCAGATCAACAACGTCATCGGCGTGGACCCAGAACTGTACGAATATATTCTGATGGTGGACGCCGACACATCT
GTGCGCGAGGACTCTCTAAACCGCCTGGTTGCTGCGTGTGCCAACGACGCCAAGATTGCCGGCATCTGCGGTGAGACTAG
TCTGCAGAACGAGAATCAGTCCTGGTGGACCATGATCCAGGTGTACGAGTACTTTATCTCTCACCACTTGGCCAAGGCAT
TTGAGTCTCTCTTTGGCAGTGTTACGTGTCTTCCTGGTTGGTAAGTTTTTGTTCCGGCTTTTTTTGCTCCTGTTTGCGAA
AGCCGTGCTAACTATTCTAGCTTTACCATGTATCGTCTCCGCACGGCCGACCGTGGCAAGCCGCTTATTATCTCTAGCGA
TGTCATCCGTGAATACAGCGACTGTATCGTGGACACGTTGCACAAGAAGAACCTGCTATCGCTAGGCGAGGATCGGTTCC
TAACTACGCTGATGACCAAGCACTTTCCGCAAATGAAGTACAAGTTCCTCCCGGCTGCGTACTGCTCGACGGCGGCGCCT
GAGACGTGGAGTGTTCTTCTCTCGCAGCGGCGTCGGTGGATCAACTCGACCATCCACAACCTTGTGGAGCTGATGTTCAT
CGAGGAAATGTGCGGCTTCTGTCTGTTCAGCATGCGCTTTGTGGTGTTCATGGACCTTTTCGGCACCGTCATTCTCCCGG
CAACGGTTGTATATCTCGTCTACCTCATTTACAACGTGGTCCACAACCACGGCTCCCTCCCGATCCTCTCCATCATCATC
CTGGCGGCCGTCTACGGTCTGCAAGCGATCATCTTCATCCTCAAGCGACAGTGGCAGCACGTGGGCTGGATGTTTATCTA
CCTCCTGGCCTTCCCCATCTATTCGTTTGTCCTGCCGGTCTACTCGTTCTGGAATCAAGACAACTTCAGCTGGGGTAACA
CGCGTATCGTCATTGGCGAGACGGGCAAGCGCCAGCTGGTGGCCGTCGACGAGGAGGGCTTCGACACACGCTCGATCCCG
CTACAGCGCTGGGATGACTATGCTATGGCGAACAACCTGCCAGGCCGCCGCGGTGGTCCTCACGGAGAGAAGGCCATGGG
TGGCCCCGAAGGCATGTACGACGAGGGCATGTACGAGATGGACGACATGAAGTCAGTATACTCGTCCATACGCCAGCCAT
CAGTCCTGGCCGGCCTGGGTACTCGCGGTAGCACCTTCATGCCGCCCCAGGCTGGACAGTATGGACAGCAGCTCTCGCCC
GGGCTTCACGGCCGCACCTCCACGATGGGCACCATGCAGTACGCCGATCACCCCATGCACCGCCAGTCCATGGCCAGCAT
GGGTACCGGAGTCCCGCGCATGGCCAGCCCGTATCTGGACGTTAATGGCGCCCGATCGTCGGGCAACCTGCAGTCTCCGG
GTCTCAACGGGTATGCCGGCCTGCGCAGCACCACCAGCCTTGCTCTGAACGGCAATGGTTCACGGATGGGCGATGGACGT
CAGTCGGCACTGTCGTTTGACTTCCAGCGTAGCACCAGCGGTCCCGACGACGGCATGATCATCGAAGCCATCCAGGGTGT
CCTGCGCGAGGTCGACCTCGACACGGTCACCAAGAAGCAAGTGCGTGCTCTCGTCGAGCAGCGGCTGCAGACAGAGCTCT
CCGGCGAACGGCGGACCTTTATGGATCGCCAGATCGACAACGAGCTGGCAAACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62