GenePrediction:GLEAN_7495 Details

Name: GLEAN_7495
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1741543..1737945 (- strand)
Length: 3599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1741543..1740813 (- strand)
Length: 731
Type: CDS
Source: GLEAN
Position: GCSC_140:1740055..1740030 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:1739953..1737945 (- strand)
Length: 2009
>GLEAN_7495 class=GenePrediction position=GCSC_140:1741543..1737945 (- strand)
ATGGAAGCTAAACGCATCAATGCCACCGACGCTGGCCGTCCGGTTTCCTCCGAGCACAGCCTCGGACAGGGTGAGTACAG
GCTGACCCCCTCGTCGTCGACCAGCTTTGTGGCCAACCACGTGGACTTTCGGTGTCCTGATGCTGACGTCCGCCGCAAGA
CCGAGGGCACGCGAAGAGTGCAGTGGATCGTAGACATACAGCGAAAGGCCCACGAGGTCTACATGCAAGCCGCCCACTCG
CACACGCAGCTGGCTAAGAGCCGGACGCGGCGCCTGCCGATCGACGGCGACGAGGACGAGTTGGGCGACGAGGCGACCAA
CGTCGGCGATCTGCTCGACCAGCTGGCCGCCTGCATGGTCTCGGACCGGGGCCAAGGCCAAGGTATGGACTGGCGCCAGC
CGGGCCAGCTGGAAGCATTTCTGGGCAAGTGCCTCGAGAGTTGGCAAGCACATGGCGCCATCCTAGAAATACACGCGCAG
CTTCAGGAACACCTGCAGGACTCGCTTCGCGCCATCGGCTGCCTGAAGCGTCACCTCAAGCAGACAGAGGAGGACAACGA
GCTGCTCCGATGGTACGCCGTGCAGCTCAGAGACGGCGCTGGCACCTCGGGACTAACCACTCCCGTTTCCCTCGCGTCCT
CGTCAACGACAGCCAACATCCTCCAAGAGGCCAGGGAGGCGGCAGCGAGGGCAGCCGCAATACAGGCTGCAGACGTGGCA
GAGACTGCACAGTAAGTTCCGGCTCAGAGTGTGTATGTCCCAGCCTCGTCCTGTTCGTATAAGTCAGTTCGTGTTTGGCA
GTCGTTTTACTTGAAACTGCTTTTCGTTTCCATAGTTGAGCTTGCACTTGATATTTAATCGAACCAAGATATCGATCCAT
GATGACCAGTTGCATCCACAATAGCCAGGGCGGATACATGTGGTTCAACTGTCGAGGCACATGTCGCGCAGAAACTTGTT
TGCCATAATGGCGTTGTATGCAGCAGCTCGTGTTCCAGAAATAGCAGGCAGTCCGCTGCAGTCGCTAGTGCACATGCCAG
TCCGGTTTGGGATTAGTGCATAGATGAACCGTAAGCTTCTAAACTCTCCTTATCGCCATCTTTCACAAACGACGGCCTTT
TCATGCTCGACTGTTGTGTCGTGCTCTTTGTGGCTCGCTTTCCTTTGTAATCTTTGTGTTGTGTTTCTTGACATTCGCTA
GATCCTACCTTCGTTTCTGCGCATCTTCGAACTCGGTCTCCTCTAGTCAGAATGCACAGTGGACACCATCTACGCCGATA
TCCTTCAATTCGTTACTCGAACTGTGTCCGCTTCTGTAGCCGACCGGTGACGTCGCCAATCGAAAAGCATTCTCCTTCTT
TCGAACCATTCGCTTGCTTCTCTCGCTCCTGGGAGCCGTTCCGACAACGCCACGGCCATTCGACGAGATCGTGGGCTTTA
AGCCAACAAACACGATTGGTGACCCTGTTTCCCTCGTTGTATTGAAAGGGTGTTATTCCTCATGGGGAAGAAATGTACGT
TGGGTGGAGCCGGTCTCTGATGGCATGCCTGGTGACCTGATGCTGACACGCCGTCCTCGCTTCTCTCCAGGGCGATATGG
TGTCATTATTGACGCCGGTTCCTCGGGCAGTCGGGTGCATGTGTATCGCTGGATCGACCACCTCCGGGCGACAAAGGACG
CGACGACAGACGAGCTGCACAGCCTGCCGAAGATCAAGACGAAGTGGACTAAGAAGATCCGACCGGGGATCTCGACGTTT
GGCGACAAGGCCAGCACGGTTGGTGCCGACCACCTGAAGGGGCTCATCGACTATGCCCTCGACGTGGTCCCAGCCGAGAT
GGTTGCGGACACGCCCATCTTCCTGATGGCGACAGCCGGCATGCGGTTCCTCCCACAGCAGCAGCAGAACGCGGTTCTGC
GCGAGTCGTGTGCATACCTGCGACAGAACACGCAGTTCTCGCTTCCCGACTGCACGCAGAACATACAGGTGATCTCGGGC
GAGACGGAGGGACTGTTTGGATGGATCGCGGCGAACTACCTTCTCGGCGGCTTCGACCACCCCGAGCAGCACGCACACGG
CCAGGACCACCACACGTACGGGTTCCTGGACATGGGTGGCGCGTCGGCGCAGATCGCCTTTGCGCCCAACAGCACGGAGG
CGGCACAACACGCAGACGACCTAAAGCTGGTGCGTCTGCGCACACTTGATGGCCGGCTGGCGGAGCACCGGGTGTTCACG
GCCACATGGCTCGGATTTGGGGTCAACAAGGCTCGAGAGTCCTACGTGGCAGAGCTTGTGCGGCAGAGCAGCAGTGCCGA
GGGCGATATCTCGGACCCGTGCATGCCCAAGGGATTGCAGACGACGCTCGAGGGGCCGACGCTGGTGGGCGCCGGCGACT
TTGCCGGCTGTCTCACGGCGACGAAGCCGCTGCTGGCCCAGGACAAGACGTGTGGCGATGGGTCGCACCCGTGTCTGATT
CACGACTCGGTGCCGAGTATCGACTTCAACGTCAACCACTTTATCGGGGTGTCGGAGTATTACCACTCGACGCACGGCTT
CTTTGGCGAGAAGGGAGACCAGGCATACGACTTCAGCACGTACCAGCACAACGTGCTCGAGTTCTGTGACCAGGACTGGA
GCCAGATCCAGACGGACATCGAGGAGAAGCAGAAGCAGAAGCAGTCGGACACGACACGAACGCTGCAAGACGCACAGCAG
GCGTGTTTCAAGGCATCGTGGGTGATCAACGTGCTGCACGAGGGCATCGGGATTCCGCGGGTGGGACTGGAGAAGCTGCC
GGGGATCAACGTATCGCACGAGGCGCTGGAGGGAGCCAAAGAGCAGGGGTTTGCGACACCATTCCGGCCGGTGGACAAGA
TCGACAGCGTGGAGGTCAGCTGGACGCTGGGCCGGATGCTGCTGTATGCGGCCGGACAAGTGCAGCCGTACAAGGGGGAC
GGCAAGGAGGATCTGGCGGTAGGCTTTGGAAGCAACGTGCAGGACGACAGCACGCCGGCGGACTTTTCGTATGCGGGCTC
AACGTGGGAGCGGCCTCAGGCTGGAGGCAGCCTGGCCGACACAACACAGAAGCGGTCGGTGTCGCCGGGGCTGGTGGTGT
TTGTGCTGGTGGTGGCTGTTGTGGTGTCTCTGCTGCGGAAGAAGGAGAAGCGGACACGGCTGTCGAGCTGGTTCGGATCG
TGGACGCGGCGGCCACGAGGACCAGGAGGGCGGTTGTTGTCGAGTCTGGCGGGCAAGCTGTTCGGCCAACGACAATCGCG
AGATTACGAGCGGGTTTTGGAGGAAGGTGGCATGGAGCAGCTGGAGCTGGGCGAGCTGGAGGCAGACGAGAGCGAGATCT
CAGACGGTAGCGATGGGTCGGGACCGGGATCGGGAAGATCACAGCTGGCACGGACATCAGGGCTGGCGACACCACGGATC
GGCGTGGACGGGTTCGAGGACGTGCGGATGTTCTCAGGGCTGGACCGAAGTGGACTGGTGGTGAGGACGGAGAGCCGTGA
GAGGTTGGTGCCGAAGAGTCGGGCAGGCAGTCCAACACGGCTGAAGAGCCCAATGATGGCGGCGCTGCACGAAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62