GenePrediction:GLEAN_7496 Details

Name: GLEAN_7496
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1736786..1735671 (- strand)
Length: 1116
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1736786..1736746 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1736691..1735671 (- strand)
Length: 1021
>GLEAN_7496 class=GenePrediction position=GCSC_140:1736786..1735671 (- strand)
ATGGCGTTCAAGAACATGGATCTCATCGAGGCGCTGGACGCGTGAGTTGGTCCCCGTCTTTGCCGTCTGGCCTCTGCTGA
CCGTGACGGCCTCAGCTTCCCGGATGCGGCCAGGGACCCGGCGCGTCACGCAGCCGCCATGGCATCGCTATACACGGTTG
AATGGGCCGACAGCGACGACGAGCGGCCGTATGCCATCGGCTACATGCAGCACAGCGTGCTGGCGGCGCTGGCGGCGGTG
CGACCGGTCGAGCTGGCGTCGTTGGGGCTGGCGACCGACGTGGACGTGGCAGCCGTGGCAGCAGCTACGGGCACGGTGCC
GCTGCATCGACTGCTGGCCGGCCATGCGGATGTGGAGGGCCGCACGCGGGCGATGGCTGCTCTGTGTGCACACTGGCGGG
CGGCCGACGCGTTCCGGCTGCTGCGCGGCTGGCGCGACGAGCTGTGGCCGGTGTACGGCCGCGACGGCCGGCTGCTGCTC
AGTCTGGAGCGGGCGGCCGTCGGGCTCTTCGGGGCCGCTCGCTACGGCGTACACATGACGGCCTACGTGGACGACGACCA
GACGGATCTTCGCATCTGGGTCCCCAAGCGGGCCGCCGACAAGTCCACGTATCCCGGCATGCTCGACAACACCGTCGCCG
GCGGCCTGATGACCGGCGAAGACCCGTTTGAGTGCCTCGTGCGCGAGGCCGACGAAGAAGCCTCGCTGCCCGAACGCGTC
GTCCGCCAAAACAGCCGAGCCGTCGGCACCATCACGTACGTGTCTGTGCCTGACGAGCGCGCCGGCGTCGATCCCGGCTG
CGCCTACGTCTATCCCGAGTGCCAGTGGGTTTACGACCTGCTGCTGCCGGCTCCCTCTTCTGGCCACGACGACTCAGACA
AAGATATCATCCCCTTGCCCAAGGACGGCGAGGTCGAGTCGTTTGCCCTCTGCTCTGTCGCTGAGGTCCGTGACCAGCTT
GCTCGCGGCCTCTACAAACCCAATTGCGCCGTCGTCATGATCGACTTTCTGCTGCGCCACGGCCTCCTCACTCGCGACGA
CGAACCCGACTACGACGCTATCGTCGCCCGTCTGCATCGCGTCCTCCCCTTCCCTGGCCCGCACCAGCATGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62