GenePrediction:GLEAN_7497 Details

Name: GLEAN_7497
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1734547..1733038 (- strand)
Length: 1510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1734547..1733827 (- strand)
Length: 721
Type: CDS
Source: GLEAN
Position: GCSC_140:1733765..1733038 (- strand)
Length: 728
>GLEAN_7497 class=GenePrediction position=GCSC_140:1734547..1733038 (- strand)
ATGTCATTTCGCAAGCGCAACGTCGTCCTGTCGGCGGGGTCTTCGGGGGGGAGCCCGGCCGCAGCACAGCCGCAGGAGCA
GAGGAGCATGCCGACAGCAGCATTGCAAGCAGCACGGGGTGCACCAGTGCGGCGAGCACAGATTGTGATTCCACAGCAGG
AGCAGGAACAGGAGCAGAAGAAGGAGCAGCGGCACCTACCCGACGTGTCGACCTGGACGGTCTCCTCACCGGTCGAGCTG
TCGGCTGCGAGACGGGCCGAGCTGGCACCGGTCAAGCAGCAGCTGCGCCTGCTCCTGGAGCAGGAGAGACAGACGCGGGC
TGGTATCCGTGGCCGGAGGACGGCAGCACCGGTGGCGGCTCTCGGCGGCGGAGCGCGGCCGTCGCCGTTTGACGGGCGGC
CCATCACGTCGACGGGGACGGCATCGTTGGATGTCTTGTTGGCTGGCTACGGTGGCCTCCTGCTTGGTCACTCGCTCCTG
GTCCAAGAACAGGGCACGACCGACTTTGCCGGCGTCCTGCTGCGGGCTTTTGCCGCCGAGGGCCTCGTCCAAGGTCATCA
CGTTCATGTTCTCGGCTTCGGCCACGGCTGGGAGGCCGAGCTGCCCGGCATCGCGTCCACGTCGTCATCCAGGAAACCGG
TGCCCGACGCAGACAGGATGAAGATCGCCTGGCGCTACGAGGGACTGTCTGCTCGTCCTGGAGCCGGCAGGTCTCCTGCT
GGTGAGTGTTTTTCCTTCTCTTCTCTGATTCTCTCCTCTTCTTCTCCTTCTAACACCAACAGGTCCAATTACCACCACCA
ACATCACCCCCTTTTGCCACACCCTCGACCCTAGCAGACGTCTCGGGCCCGCTGACATCAAGGGCACGCTGCACCCGTTC
CCGCTGCCGAATCCGCTTCTGCCGTCACGCACGCCCGAACCGGTACACTCGCCGCTCCGCGCCTTTCTGGCCAGTGTGCG
GGCCAGCCTCGAGGCCACGCCGCCGTCGGCCGTGCACCGCGTCGTCCTGCCGGCCTTTCTGTCGCCCACCCTCTACGCCA
TGGACGGCTGGAGCGCCCCCTACATCCTCAGCCTGCTGCTCGGCCTGCGCAGCCTCCTGCGCGAGCACGGCCGCCGCCTG
ACCGTCATGCTGTCGCTCTCGACCTCGCTCTACGACCGCGCCGACTACAGCGTCCGCCAGCTGGAAAGAGTCTGCGACAA
CGTCGTCGAGCTCGTCCCCCTGCCGCCTGGACGGCCGTCCGCCGCCTCAGCTGCCGCCAGCAACACGCCCACGTCGCCCG
CCGACAAGATGCAGGGCTGGTTCCGCGTCCACAAGCTGCAGGTCTACTCCGAGACCGGAGGCGCCGGCGCCAGCCCCCAG
GGCAGGGCCCTGCGCGAAAACTTTTGCTTCAGCATGAGCGCCTCCAGGGGCCTCGAGATCGCCCCCTACAGCCTGCCGCC
CGTCGACGACGGCAACCACAACGACAAGTCTGCCCCGGCCAGCTCTACGAAAGAAGGCATCGAGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62