GenePrediction:GLEAN_7499 Details

Name: GLEAN_7499
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1673079..1670181 (- strand)
Length: 2899
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1673079..1673008 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_140:1672937..1670385 (- strand)
Length: 2553
Type: CDS
Source: GLEAN
Position: GCSC_140:1670318..1670181 (- strand)
Length: 138
>GLEAN_7499 class=GenePrediction position=GCSC_140:1673079..1670181 (- strand)
ATGGCGTACCACGGCCATGATGGCGAGGATTACGGTGGCCACGATTTGCAGGATCTGCCGTCAGGGAGCCAGGTAAGAGC
CACACCGGCTTCTCATAACCACATAAAGCTCAGCATGCTGACGCTTTGTGAACGCATTACAGTATCACCTGCCACCAACA
GATGAACCCGACGAGTCACAACACGCCCTCTTAAACCAGGGCACGTCGCCATATGACCACGATCACTTGAGTGCCGGCGT
GCCTGCCATCCGGCCGGAGTCGACCTACAGCTTGACCGAGTCCTACACTCCTGGTGCTAGTACCACCGTTCGTGGTGCTT
CGGGAGCCTTCCCGCATGCCCCATCCCCCTTCCAGAATGACACTGGTATGTCCAGTAGCGCCTACCGGCCAGAGCAAGAC
CCCTACGGTGGCTTCGGCATTCAACGACCCCAGTCGGCCATTTCGGTGGCTGGCGACCCAGACGACAGCTTCTACCGGCG
TCAAAAGCAGGCTGCTGGCGGTGGCCTCAAACGCTACCCGACGCGTAAGGTCAAGCTTGTCCAGGGCTCTGTCCTGAGCA
TTGAGTATCCCGTCCCTAGCGCCATCCGCAACTCGGTTCAACCAGAGTATATCGAGAATGAAGCGAACCACGACGAGTTC
TACAAGATGCGATACACCGCTGCTACTTGTGATCCGAACGATTTCACTCTCAAGAACGGTTATGACTTGCGCCCGCGCAT
GTACAACCGCCACACAGAGCTGCTTGTTGCCATTACCTACTACAACGAGGACAAGGTGCTAGTGTCTCGTACTCTGCACG
GTGTCATGCAGAACATTCGTGAAATTGTCAACTTGAAGAAGTCCACTTTCTGGAACAAGGGTGGACCTGCGTGGCAGAAA
ATTGTTGTCTGTCTTGTCTTTGATGGTCTCAACAACACCGACAAGAGCGTGTTGGACGTCCTGGCTACCGTTGGCATCTA
CCAGGATGGTGTCATCAAGCAGGATGTTGATGGCCAGGAAACTGTCGCTCACATCTTTGAGTACACCACACAGTTGTCCG
TGACGCCATCACAACAGTTGATTCGTCCTGTCGGTGACAGCAAAAATACATTGCCGCCCGTCCAGTTCATCTTCTGTTTG
AAGCAAAAGAACAGCAAGAAGATTAACTCTCACCGCTGGCTCTTTAATGCTTTTGGTCGCATCCTGAACCCCGAGGTGTG
TATTCTGCTCGATGCTGGTACTAAGCCCAGTCCGACGTCGCTGCTTGCCCTCTGGGAGGGATTTTACAACGACAAGGATC
TAGGTGGTGCCTGTGGTGAGATTCACGCCATGTTGGGCAAGAACGGTCGCAAACTCTTCAATCCTCTCGTGGCCATCCAG
AACTTCGAGTACAAGATTTCCAATATTCTGGACAAGCCCCTTGAGAGTGCTTTTGGCTACGTCAGTGTGCTGCCTGGTGC
CTTTTCGGCCTACCGCTTCCGTGCGATTATGGGTCGTCCACTCGACCAGTACTTCCACGGTGACCACACGCTATCTGCTA
TTCTTGGCAAGAAGGGTATCGAGGGCATGAACATTTTCAAGAAGAACATGTTTTTGGCCGAGGATCGTATTCTCTGTTTC
GAATTGGTTGCCAAGGCTGGTCAAAAGTGGCATCTTTCCTACATCAAGGCCGCCAAGGGTGAAACTGATGTGCCAGAGGG
CGCCCCCGAGTTCATCAGCCAGCGTCGTCGTTGGCTTAACGGTTCCTTCGCAGCCAGCTTGTACTCTGCTATACACTTCG
GTCGATTTTACAAAAGTGGGCACAACATCGTTCGCATGTTCTTCTTCCACGTCCAACTGCTATACAATTTCGCCAACCTT
GTCTTCTCCTGGTTCTCGCTTTCTTCTTACTGGCTCACGACGTCTGTCATCATGAATCTCGTTGGTGAACCTGACACGAC
AACGAAGCACCACGGTTGGCCATTTGGTGACACGGCAACTCCTATCATCAACTTCATCTTGAAGTATATCTACTTGGCTT
TTGTTATTCTGCAATTCATTCTGGCTCTGGGTAATCGGCCGAAGGGCTCGAAGTATGCATACATCGCATCATTTGCCGTC
TTTGGTATCATTCAGGCCTATATCTTGGTTCTTTCCGTCTACCTGGTAGTGCGAGCTCTGCAGACGCCGGTCAGCGAACA
GATCGACACAGACAATATCCACGACTTTTTTGCTAGTGTGTTCGGTACGAATGCTGGTGCAGCCGGTGTCATCATTCTGG
CTCTCTTCACGATTTACGGCATCTACTTCATTGCTTCCTTCCTATACCTTGACCCCTGGCACATGTTCCACTCCTTCCCC
CAGTACATGATTCTTATGACCTCATACATCAACATCCTGATGGTTTATGCTTTCAACAACTGGCACGATGTATCGTGGGG
TACGAAGGGTTCGGACAAGCAAGAGGCACTTCCTTCTGCACAAATCACAAAGGGTGAAAAGGATGAAGTGGTGGTTGAAG
AAATTGACAAGCCGCAGGAGGATATCGACAAGCAGTTCGAGTCCACGGTGAAACGTGCCCTTGAACCGCCCAAAACTGAG
GAGGAGGTGGAGGTCAAGGACATTCAGGACTCATACAAGTCTTTCCGGACGATGGTGGTCATCTTGTGGCTCTTTTCCAA
CTGCCTATTGGCCGTTGTTATTACGAGCTCGAACTTCGACAATCTTGGTCCTTCCGTACGTTTCATCCTTTATGTTTGCT
TTGTCGGGCACTTTGCTAATCTTTTTTTTTCTTTTGAACAGAGTACTACCACGGCCCGTACTGCTTGGTTCTTCAGATTC
TTGCTTTTCGCTACTGCTGCACTGTCTACGTTTCGCTTCATCGGTTTCCTCGTGTTCCTCGGCAAGACCGGCCTCATGTG
CTGTATTGCTCGACGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62