GenePrediction:GLEAN_749 Details

Name: GLEAN_749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1865586..1867532 (+ strand)
Length: 1947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1865586..1865596 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_97:1865662..1865738 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:1866028..1867532 (+ strand)
Length: 1505
>GLEAN_749 class=GenePrediction position=GCSC_97:1865586..1867532 (+ strand)
ATGGCGCCATCGTACGTCCCTGTTACTTTTACGGGTGTTTTTTGTGTGTCTTGCTGACAGCTAATTGGGTGTTTAGACAC
AAGAAATCCGTCCTGTCCACGTCGGCGAAGGCGGTAGACCCCTCTCTGGATGCACTGTTTTCGACGAGTGTGAGTACTTC
TGACTGGCAGTAGTTTGGAAAGCCCGTTCTAACTCTGGCCACAGGCAAAGCCGGTTGCATCCCAGAATAGGCCGAAGTAT
GTTGGTCTGATCACTCCGAAAGCGCGGCCTGCGCCGAAGACAAAGCCAGTGAAGGAACTAGACGAAGAGGAACTGGCAGC
GAAAGAAGATGAGGATGAAGACGAGGATGATGATGACCAGGACGAGGACGAGGACGAGTTTGAGGAGGCTCCCGACAAGG
CAGAGGACGAGTTGGCCGAGGAAGTAGAGACGGCGGAGCCAGAACCGAAGAAGGGCCTCGGAAAGCGGAAACGAAAAGCC
CGTGACGAAGGAGAGGACCTAGAGGGCAGATACATGGACAAGCTTGCCCGAGAGACAGCACCGGCCGAGGAGCGTCCTCG
CCGGACGGACGAGGATGCCGAGGACGTCAACATGGACGACGAGCAGGAGGAAGAGGCCGAGGACGACGAGGCCGACGAGC
CGTTGGTACACGAGGCGCTTGGAGAAAAGACCGGAAGCACGGGTGCTGGTGCTGGGGGCGTGCCGGAGACAGAGAAGGAA
AAGGCTGCGCGGACGGTGTTCCTGTCAAACGTGAACATTGAAGCAGTGACGTCGCGCACAGCCAAGAAGACGTTGTTGGC
ACATCTAGCATCGCCGCTAGAGGCGATGAACGCAGCCGTGACTGAGGCGGCAGAAGCAGCGGCAGCAGTGGCAGCAGCAG
AGGTGAAGCCAGCAGCAACAGAGGAGTCGTCAGAAGCAGCAGCTGCGGCAACGACCAAGCCAGCAGGGCCAACACCGGTG
CTGGCGACGGTGGAGAGCCTGCGGTTCCGGTCAGTGCCGTTTGCGACGGCGGCGATGCCGAAGCGGGCGGCATTCATCAC
AAAGGCGGTGATGGGAGCTACGGCGCAAGCAACGAATGCGTACGCGGTGTACTCGACGGCAGCAGCAGCGCGACAGGCGG
TGCGACAGCTGAACGGGACGGTAGTGCTGGGACGTCACTTGCGGGCAGATAGCGTGGCGCATCCGGCAGCGGTGGACCAC
CGACGCTGCGTGTTTGTGGGCAACCTTGGCTTCATGGACGACGAGGAGGTGATGGTGACGCCGGACGAGGCGAAGACGGA
CGAGGACGGGCAGCCGGCCGAGCCGACGAAGCGGAAGCGTTTCAAGGTGCCCATGGACGTGGAGGAGGGACTCTGGCGGA
CGTTTGGCAAGCACGCGGGTGCGGTGGAGAGCGTGCGCGTGGTGCGTGATCCGGCGACGCGAGTCGGCAAAGGCTTCGCC
TACGTGCAGTTTGTCGATGGGACCAGCGTCGAGGCTGCGCTGCTGCTGGCCGGCCGCAAGTTCCCGCCGCTGCTGCCGCG
TGAGCTGCGTGTCAGCCGCTGCAAGGCGCCCCAGAAGACGCTGCGCGCCGTCGAGCGTCAGCAGCAGGCCGCTGCTGCCA
AGATCAACACCCGTCGCGACGACCGCAAGCGCACTCGCTACGCTCCCAAGCCTACGGCCGAACAGCAGTCTGCCGCTGGT
CGCGCCGCCAAGCTGCTCGGCCGCGCTGCCGCCCGCACCGTCACCGCCACTGGACCCAATGCAGACGTCCTCGCCCCTGC
CGATGGCAAGCCGCTCGTGTTTGAGGGCACGCGCGCTCGTGCTGGCCAGGGTGGCGGCATCGGCGGCAAGAAGAGCCGCG
GCGCCGGCAAGAACGGAGGCGCCGGCAAAAACGGCGGCAAGACGTCCAACAACGACGAGCGGCGGGCCAAGCGGGCGTCC
AGCTGGCGCGGAAAGACGAAACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62