GenePrediction:GLEAN_74 Details

Name: GLEAN_74
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:476407..477876 (+ strand)
Length: 1470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:476407..476689 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_179:476756..477876 (+ strand)
Length: 1121
>GLEAN_74 class=GenePrediction position=GCSC_179:476407..477876 (+ strand)
ATGGTTATGGCAACAGCCATCTTCGATCGTGTCGCCCCCGTTACATTTAATCATAATAGTAACGTTGGCTTCCTCAAGAA
GAGCTTTCATCATGGCGCAACGCAGTGCCAGTCTACTGCCAAGCAACTGATTGGCAATGCTCTCCGCCACCGCGTGGAGA
CCATTGACCATGAATTCTGTGAGCCTGGCGACGAGGACACCTTTTTCGTCGCCGACCTCGGCGAGGTCTACCGCCAGCAG
CTCCGCTGGAAGATGAATCTTCCCCGCGTCAGGCCCTTCTATGGTCAGTTCCTGCCACTGTGCATAACAGAGAAAAAGCT
TGGCTGCGTGCTGACATGAGGATGCACAGCCGTCAAGTGCAACCCCGATCCCAAGGTGCTCCAGCTCCTGGCCGGGCTCG
GCAACGGGTTCGACTGCGCCTCCAAGGCCGAGATCGAGCAGGTGCTCAACATGGGCGTGGACCCGTCGCGCATCATCTAT
GCGCAGCCCTGTAAGACGAACTCGTATGTCCGCTACGTCGCCGCCCACGGCGTCCGCCAGATGACCTTTGACAACGCCGA
CGAGCTCCGCAAGATTGCCAGGTTGTTTCCCGACGCCGAGCTCTTCCTGCGCATCCTCACCGACGACAGCTCGTCGCTGT
GCCGTCTCAGCCTCAAGTTCGGCGCCTCGCTCGACACCACCGACAGCCTGCTGGCCCTGGCCCGTGAGCTCGGGCTCAAC
GTTGTCGGCGTGTCCTTTCACGTCGGCTCTGGTGCGTCAGACCCGAGCGCCTTCCTCAAGGCCGTCCAGGACGCCCACTC
GGTCTTTCTTCAGGCGGCCGAGTACGGCTACAGCCTCAAGACGCTCGATGTTGGCGGTGGCTTTTGCAGCGACGCCACCT
TTGAGGCCATGGCCGAGGTGCTGCGCAATGCGCTGGATGAGTACTTCCCTGCCCACCGCGGCGTGTCCATCATTGCCGAA
CCCGGCCGCTACTTTGTGTCGTCGGCCTTTACCATTGCCTGCAATGTCATCGCCCGGCGCACGGTTGAGAACCCGCCGCA
GCAGCAGCAGCGGGAGGATGCAGTGGACGGCATTGTCGCGCCGGCGGACCCGACGTATATGCTGTACGTCAACGACGGTC
TGTACGGCAACTTTAGCAGCATCATGTTCGACCACCAGCATCCCGAGGCCAAGGTGCTGCAGACGGGATCGCGGTTTCTG
TACGACAGCGAGACGGCGAATGCGGTAGCGCCCACGAGCGGCCTGGAGTATTCCATCTGGGGTCCGACGTGTGACGGAAT
TGACCGGATCACGGAGAGCATCCGGTTTGGCCACACGCTCGACGTGGGCGACTGGCTGTACTTTGAAGACATGGGTGCGT
ATACGCGCTGCTCGGCCACGCGCTTCAACGGCTTCTCGGACAACCACGAGATCATCTATGTGTGCAGTGAGCCGGGTGCG
CGTGCTCTGATTGGGATGCATAGCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62