GenePrediction:GLEAN_7500 Details

Name: GLEAN_7500
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1669134..1668364 (- strand)
Length: 771
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1669134..1669114 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:1669028..1668935 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:1668873..1668584 (- strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_140:1668519..1668364 (- strand)
Length: 156
>GLEAN_7500 class=GenePrediction position=GCSC_140:1669134..1668364 (- strand)
ATGCTGAAAATCTGGTCTATGGTAAGTTATGCTGCTGCATGTGCTGCAGGTGCCTATGGAAGCGGACTTAAGTACCTTAC
AAACTACTGACATCGCCTGTCTGCAGAAAAAGGAGCAGCAGAAGGCTGAGAATGCAGAGGGAGCGGCAGCCGGTGGCAAG
AAGAAGAAAGTAACAGCAGCGCAGCTGCGGATACAAAAAGGTATGATGCAGTGATGATATGCCAAGAAACTCGGGTCTTC
TTCAGTCACTGATTTCTCCAGATCTCTCCGAGCTTTCACTTGGAAACACGATGCGCATTGACTTCCCCGACCCAGACGAC
ATTCTGAACTTTGTATTGACTATCGAGCCTGACGAGGGAATGTACCGCGGTGGTCGCTTCAACTTCGACTTTCGCATCAA
CCAGAACTTCCCTCACGAGCCGCCCAAGGTCGAGTGCCAGCAGAAGATCTACCACCCAAATATCGATCTGATGGGCAAAG
TGTGCTTGAACATCCTGCGTGAGGACTGGAAACCTGTGCTCAATCTCAATGCAGTGATTGTTGGTTTACAGGTGAGACAA
CTACATGCGTTTCTGTGTATCTCACTGTGTGATTCCCGCTTACTCTAGCTTAAAGTTTCTGTTCCTTGAGCCGAATGCGT
CGGATCCCCTAAACAAAGAGGCGGCCGAAGACCTACGATCGCACCGAGAGAACTTCAAGAGGAACGTGCGGAACTCGATG
GCGGGAGGGTCGGTACGCGGCACCGTCTATGACAAAGTAACAATCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62