GenePrediction:GLEAN_7501 Details

Name: GLEAN_7501
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1667636..1666178 (- strand)
Length: 1459
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1667636..1667420 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_140:1667359..1667328 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_140:1667213..1666935 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_140:1666873..1666178 (- strand)
Length: 696
>GLEAN_7501 class=GenePrediction position=GCSC_140:1667636..1666178 (- strand)
ATGGCTTCTCGTGGATTCTCTAAGGCTCTGCGGACGCCAATGGCCCGCCAGCTGGCAGCTCCGGCTGCTGCTGCTCAGCG
CCGCACCTTTGTGGCTGCTGCAGGCCTGGTCCGTGCGAAGGCTGCCGTGAAGGCTGCTACGTCGACCATGACTGCCCAGC
AGCAGGTCCGTGGTGTCAAGACCATTGACTTTGCCGGCTCCAAGGAGCAGGTGTGGGGTGGGTTTTTATCCGGATCTCTC
TGGCAGTGTTGATACATAGGCTGATGTTTATTTTCAGAGCGTGCCGACTGGCCTCGTGAGAAGCTTCTGGTGAGTTACTG
CTCTACAAGGCGAGAGAGGTGGGGCGAGTTTAGCGGGATACGGTGCAGGATCTGGAGCAAGTGGGTGAATGTTACAGTGT
GCTGACTATGATGTCGTTTGTAGGAGTACTTCAAGGACGACACGTTCGCCCTGATTGGCTACGGCTCGCAGGGCCACGGC
CAGGGCCTCAACCTCCGCGACAACGGCCTCAACGTCATCATTGGCGTGCGCAAGAACGGCAAGTCGTGGAAGGATGCTCT
TCAGGACGGCTGGGTCGAGGGCAAGAATCTGTTTGAGGTCGACGAGGCCATCAGCCGCGGCACCATTGTCATGAACCTGC
TCAGCGACGCCGCACAGTCGGAGACGTGGCCGGCCATCAAGCCGCAGCTGACCAAGGGCAAGGTGGGTTTTTCGCTCTCT
CTTTCTTTATTTTTACTTAGTAGATATGATGCTGACTCAGCAGACCCTGTACTTCTCGCACGGCTTCTCGCCCGTGTTCA
AGGACCTGACCAAGGTGGACGTGCCGACGGACATTGATGTGATCCTGGTCGCGCCCAAGGGCTCTGGACGGACGGTGCGA
TCGCTCTTCCGCGAGGGCCGCGGCATCAACTCGTCGTTTGCCGTCTACCAGGACGTGACGGGCAAGGCCGAGGAGAAGGC
GCAGGCGATGGGTGTGGCGATCGGCTCGGGCTACCTGTACAAGACGACGTTTGAGAAGGAGGTGTTCTCGGACCTGTACG
GCGAGCGCGGCTGCCTGATGGGCGGTATCCACGGCATGTTCCTGGCACAGTACGAGGTGCTGCGTGAGCGTGGCCACAGC
CCGTCGGAGGCGTTCAACGAGACGGTCGAGGAGGCGACGCAGAGCCTGTACCCGCTGATCGGTGCCAACGGCATGGACTG
GATGTACGAGGCGTGCTCGACGACGGCGCGGCGTGGCGCCATCGACTGGTCGCCCCGCTTCAAGGATGCCCTGAAGCCGG
TGTTCAACAGCCTGTACGATTCGGTGCACGATGGCAGCGAGACGAAGCGGTCGCTGGAGTACAACAGCCAGCCTGACTAC
CGCGAGAAGTACGAGGCTGAGATGGAGGAGATCCGCAACCTGGAGATCTGGCGTGCCGGCAAGGCCGTCCGCTCTCTGCG
CCCGGAGAACCAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62