GenePrediction:GLEAN_7503 Details

Name: GLEAN_7503
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1661565..1660128 (- strand)
Length: 1438
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1661565..1661265 (- strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_140:1661209..1660128 (- strand)
Length: 1082
>GLEAN_7503 class=GenePrediction position=GCSC_140:1661565..1660128 (- strand)
ATGTCGCTCACAGACGCAGGGCCAGCCGAGGCGGCACGCGCGGCCAAGACGGCGTCGCATATTCTAGCGACGCTGTCGGC
AGACGAGCGCAACTCGGCGCTGACGGCGATGCACTCGGCGCTGACGGCAGCACGCGAGACGATCCTGGAGGCCAATGCGG
CCGATCTGGCAGCAGCAGAGCAAGAGGCAGCGGCCGGACGGCTAAACCCATCTCTGGTGTCGCGTCTGGATTTGGGCCGC
AAAGGAAAGTGGGAGGACATGCTACAAGGCATCCTGGACGTGCGAGCATTGCCAGATCCTCGTGAGTTTGCTTGAGAGGC
GTACAGAGACAAAGAAGCCGGACTGACAGGAAGCAGTCGGCATTGTGACGATCCGCACGCGGCTGGACGACGGGCTCGAG
CTGGAGCGGGTGTCGTGTCCGATCGGTGTGCTGCTGGTGATTTTTGAGGCGCGTCCGGAGGTGCTGGCCAACATTGCAGC
ACTGGCCGTCAAGTCGGGCAACGCAGCCCTGCTCAAGGGTGGCAAGGAGTCGACGCGGACGATGTTGGCGATGGCGGCGG
CACTGTCGACAGCGCTGCTGCAGAAGGAATCAGCAGTGCCGTCGGCAGCGGTGCAGCTGGTGACGCGGCGCGACGTCGTG
GCCGAGCTGCTGGCGTTGGATCGTGACATCGATCTCGTGGTTCCGCGTGGGAGCAACGAGCTGGTGCGTTCGATCAAGGC
TGGGACGCGCATTCCAGTGCTCGGCCATGCTGACGGGATCTGCTCCGTCTTTCTGGACATCGGCCTGTGCTCGCCACCGG
ATGCTGCCATGGCGGCTGCTGTGCTGCTTGACGCCAAGACCGGCTATCCAGCTGCCTGCAACAGCGTCGAGACGCTGCTC
GTTCATGCCGATGCTGTCGAGAAGCCGGCCTTTGCTGCCATCGTGGTCGCTCTGCTCGCGGCCGGTGTTACTCTGCACTG
TGACGAGGCCACGCTCAAGGCGGCCTCTGCTGCCGTGACTGCAGACGGCAACGGCCAGACGAAGACGTCGCTCCTTCGGC
CTGCTGTTGCGGCTGACTTTGACACCGAGTTCCTCTCGCTCGACCTCGCCGTCCGGACGGTTCCGTCGCTCACCGCCGCC
ATCGTCCACATCAACGAGCACGGCTCGCACCACACGGACGCCATTCTCAGTCGTTCCAGCGAGAACGCCGAGCATTTCAT
GGCCGCTGTCGATTCGGCTGGCGTCTACTGGAACGCGTCCACGCGCTTTGCTGACGGCATGCGCTATGGCTTCGGCACCG
AAGTCGGCATCAGCACCAACAAGATCCACTCGCGCGGGCCTGTCGGCCTCGAGGGTCTCACCATCTACAAGTACAAGCTG
CGCGGCACCGGCCAGGCCGCCAGCCAATATGGCGACGGCAAGCGCTACTTTAAGCACGAGCCGCTGCCGTTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62