GenePrediction:GLEAN_7504 Details

Name: GLEAN_7504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1638037..1636921 (- strand)
Length: 1117
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1638037..1637902 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_140:1637833..1637784 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_140:1637721..1636921 (- strand)
Length: 801
>GLEAN_7504 class=GenePrediction position=GCSC_140:1638037..1636921 (- strand)
ATGTCGGAAGCGGACGTGGCAACAAGAGCTCCCGAGAGCGATGCGGCTGAAGACGCAGCTCCGGGCCCAGTTCCCGGGCC
AGCTCCGATTGGCAGGACGGGCCTGAGCGACCACTGCGTGTCGGACCGGCCAGCTCGTCCGTTGCCCGCCTCTCCCCCTT
TGCTGGAGCGAGAATCAGCTGACTCGTATGATATGTGCCTGCAGCCAAGGGGCGGTCGCCAAAGGGCGAGATGCGGAGAC
TGGGCGACGTTGATGTGAGTTGGGCGTGACTCTGTCGTGGCTCTGTACTGTGTTGACAGCCGTGCGTGCGTCCCAGGCCT
ACGTCTCGAAGCCGAGGGAGTATCCCCATGCGCCAGCGCGGCTGCTGCTGCTGCTGAGCGGCGGAACGGGGGTGCGGTCG
ACCAACAACCAGATCCAGGCCGACATGTTTGCAGACGAGGGCTACGTGGTGGTGATGCCGGACCTGTTTGGCGGCGACGT
GGCGCCCAACGCGACGACAGAGGCTTCGGCTGAAGAGCAGCAGCAGCAACAACAACAGCAGCAGTCGGAGGTGCCGTCCT
TCCTGGACCTGTTCCGGAGCAAGGCGGTCGAGACGGTCAAGAGCTTCATGATCGACATGTGGCTGGCACGCCACACTGAA
GCTAAGGTGCTGCCGATCGTGCGACGGGTGCTGGAGGCGAGCCGGGACGAATTTGCCGATGCGGTGGCGAGTGGAGACGG
CGTGTATGCGGCCGGCTACTGCTTTGGCGGGCGGTACGTGCTGCTGCTGGCGGGCGACAAGGGGGAGGGCGACGTCGATC
TGGAGAGACAAGAGGCCAGGGGTCCGCTGATCCGGGCTGGGGCTGTGGCCCACGCGACGTTGGTGTCGCCAGATGATTTC
CAGGGCCTGCAGGCGCCGATCAGCCTGGCGTGCGTGGAGACCGACCCGATGTTCCCGGATGAAGTGCGTATGGCGGGCGA
AAAGTACCTGTCGGGACACGACATTGAGCACGAGGTGCAGGTGTATCCGGGGGTGCCGCACGGCTTTGCTGTCGTGGGCG
ACTACGACAACGAGGCATACAAGAGGGCGCAGGAGATGGCCTTTGGCCAGATGCTCCGGTGGTTGAATGATCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62