GenePrediction:GLEAN_7506 Details

Name: GLEAN_7506
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1629463..1626923 (- strand)
Length: 2541
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1629463..1628941 (- strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_140:1628890..1628373 (- strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_140:1628295..1627527 (- strand)
Length: 769
Type: CDS
Source: GLEAN
Position: GCSC_140:1627398..1626923 (- strand)
Length: 476
>GLEAN_7506 class=GenePrediction position=GCSC_140:1629463..1626923 (- strand)
ATGTGCGAGCGATGTGGTAAAGACGCCGGCAACTTCCAGAGACGGGCGAGTTGTGCCCGTGATATCAACACTGCGACATC
GAGGTACAGTGACATCACGACATCACGTGCACGACATCACGTGGGCGACAGCAGTGCGATTCCATCCATGGAGCATCCGC
AGGACACGGCGCAGCGTCGCGCGCTGGCAGACCCGGAGGCGTTCTGGGGCCACCAGGCGGCACAGCTACAGTGGCATCGA
CAGCCGGACGTGGCGCTGCAGCGCACGACCAAGACGCTGGCCGACGGCACCGGCCATGAGCACTGGGCCTGGTTTCCGGG
CGGGCAGATCTCGACGTGCCACAACTGCGTCGATCGCCACGTGCAGGCCGGCCGCGGTGATGAGCCGGCCATTCTGTACG
ACAGTCCGGTGACGCAGACGAAGCAGCGGCTGACGTATGGGCAGCTGCTGGCCGAAGTCGAGACCACGGCGGCGGTGCTG
CGCGAGCATGGTGTTGGCCGAGGGGACGTCGTCCTGGTGTACAGTGAGTTTCCGTCTCCTCTCTCTTCTCTTTGGGCTCC
CACTGACAGCCAGTGCCCATGATCCCCGCCACCCTCATCGGCATCCTGGCCGTCAACCGGCTCGGCGCCGTCCACACGGT
CGTCTTTGGCGGCTTTGCAGCGGCAGCATTGGCCCAGCGCATCGAGGACGCCCGGCCAGTCGCCGTGCTGACGGCTTCCT
GTGGCGTCGATGGCAATAAACCACCGATGGCGTACCGGCCGCTCGTCGAGGCTGCCATTGCGGCCTCGCCCTGGAAACCA
CCGCACGTTCTGGTCTGGCAGCGCGACCAGCTGTCGGCCTGGGATTTGCAGCAGCCGCTGACGACCACTGCCACCACCAC
TGTCTGCTGGCAGACGCTCGTCCAAGACGCCCGACGGCGTCGTGTCACCGCAGCTTGCGTGCCCGTGGCCTCGACCGACC
CCGTCTACATCATCTACACCAGCGGCACCACCGGCCGGCCCAAGGGCGTCGTCCGTGAGGCTGGCGGCCACGCTGTCGGA
CTGCACCTCAGCATCAGCTATCTGTTCAATATTCACGGGCCGGGTGACGTGGTGAGTTTTTTCCCTTCTTTCTTTCTTCT
TTCTTCTTCTTCTTTTTTCTTTCTTTCCTTCCTCTTCTGACCCCCCAGATGGCTTGCTTCAGCGATATCGGCTGGGTCGT
CTCCCACAGTTACACTCTCTACGCCCCCCTCCTCGCCGGAGCTGCCACCGTGCTGTACGAGGGCAAGCCCGTCGGCACGC
CCGACGCCGGGGCCTTTTGGCGCATGATCGAGGAGTATCACGTGACCACAATGTTCACAGCCCCGACGGCATTGCGCGCC
ATCCGCAAAGAGGACCCGGACAACGGGCAGCTGGCGGCTGTGGGCGGCCGTGGCGGCCTGCGCAGTCTGCGTGCCCTCTT
CCTGGCAGGCGAGCGTTCTGAGCCGACCCTGGTGACCATGTACCAGCAGTTGCTGGCGCGGTACGGCGCTCCGGGCGCCC
AGGTCGTCGACAACTGGTGGTCGTCCGAGTCGGGCTCGCCCATCTCCGGCATCGCCCTGGGTGCCCACGTCGGTCTCGAC
AGCAGTGCTGCTGCCGCCTTCCAGACTGCCACTTCTGGCAAGGGCTCGTCATCGCAGCTGCTGCCGCCGCTTGCCGTCCG
TCCTGGCAGCGCTGGAAAGCCGATGCCCGGTTTCGACGTGCGCGTTGTCGACGATGTCGGCGCCGAGTTGCCGCCTGGAG
CCATGGGCAACATCGTCCTTCGCATGCCGCTGGCCCCAACCGCCTTCTGCACCCTGTGGCAAGATGACGACCGCTTCTAC
CGCGGCTATCTGCGTCGCTTCCAAGGCCGCTGGCTGGACACTGGCGATGCCGGCATCATCGACAAGGATGGCTATATCAG
CATCATGGCGAGATCGGGTGAGTTACCTTGACCAAACTGGTCTCTTTTCATGTCTCTCCCTGTCGCAACACCGTCACCTT
ACCGTCACCCCCTCTCTTTCACCTTCCCTCTTTCCCTCACAATCACGCATACTTACTCACCCTAGACGACATCATCAACG
TCGCTGCTCATCGCCTCAGCACCGGCGCCCTCGAACAGGCCGTAACAAGCCACCCGCTCGTCGCCGAGGCCTGTGTCGTC
AGCATCCCCGACGCCCTCAAGGGCCACATGCCCTTTGCCTTTGTCAACACGAACCGCTCGGCCGCCTCACCGACCGACGA
GGCTCTCTTCCGCGACATTAACGGGCGCGTGCGCGCCCAGGTTGGCCCCATCGCCTCGCTCGGCGGCCTCATTGAGGGCA
GCGGCATGATCCCGCGTACTCGCTCTGGTAAGACCCTTCGTCGCGTCCTGCGCGAGCTGCTCGAGAACGCCGTCCACGGC
GACTTTGACGCTCCCGTCGCCGTTCCCTCCACCATCGAGGACCCGGCCGTCATTGACGTCGCCCGCGAACGCGTCCGCAC
CTACTTTCGCGACCACGCCGGCGATCGTCACGCCCCCATCGAGACCCGCCCCAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62