GenePrediction:GLEAN_7507 Details

Name: GLEAN_7507
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1626472..1624394 (- strand)
Length: 2079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1626472..1626429 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:1626357..1626088 (- strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:1626025..1624535 (- strand)
Length: 1491
Type: CDS
Source: GLEAN
Position: GCSC_140:1624484..1624394 (- strand)
Length: 91
>GLEAN_7507 class=GenePrediction position=GCSC_140:1626472..1624394 (- strand)
ATGGCAGCAGCAGCAGAAAGACAAATAACAAGGGGTGCCTTGGCGTAAGCTTTCCCCCCATTCCTTGCTTGCCACGTTGC
TCGACTGTGCCGCCTCTGATATGTCTTCTCTCCAGAGCCATCTTCAGCGACCCGGAAAGTGCCAGGACCCAGTTCCCCGT
CCCCGTCCTCCAGTGCCTCCAGATCAAGCCACTCGGGCCTCCGCCAAACGGAGCCGCCGGTGCCGCTGGCAGCGAGCGGT
ACCGTGTTGTGCTGAGCGATGTCGACAACTTTGTGCAGACCATGTTGGCCACACAGGGCAACCATGTCGTCCATGACGGC
AAGCTGGTCCGGGGTAGCATCGTGCGCATAAAGGCGTACCAGGCCAATGCCGTCAAGGGAAAGAAGTAGGTTTCCGGGTT
TCGGTTTCTGGTTCTTCATGTTGTTAGTTCTATGCTGACACTGGCAGCATTCTCATCATCCTGGATCTCGACGTCATCGA
ATCTCTCGGTGCTCACGACAAGATTGGTGAACCCACACCGGTCGACAGCTCCATCCAGCCCGTGGCAGCCGCGACCAGCA
CGAACATCGGCGGGACGAACTTTTACGGCGTCAAGAAGGAGGAGCCAGACACAAAGCAGGGGATCCGTGGCAGCATCGGG
GCCGCTGGCAACAACGGCAACAGCACCGGAAAGCCAAGCGGCACCAGCTACGGCGGCAGCAACGCGGCGCACCCCAACAT
CTACCCGATCGAGGGTCTGTCGCCATACTCGCACAAGTGGACGATCAAGGCACGGGTGACGAGCAAGTCGGAGATCCGTA
CGTGGCACAAGAGCAGCGGCGAGGGCAAGCTGTTCAGCGTCAACCTGCTGGACGAGAGCGGCGAGATCAAGGCGACCGGC
TTCAACGAACAGTGCGACCAGTATTACGACCTGCTGCAGGAGGGCAGCGTGTACTACATCTCAAGCCCGTGCCGGGTCAA
CATTGCCAAGAAGCAGTTCTCGAACCTGCCGAACGACTACGAGCTCTCGTTTGAGCGCGACACGCAGATCGAAAAGGCCG
AGGACCAGAGCAGCGTGCCGCAGGTGCGCTACGCCTTCTGCACGCTGCAGGCGCTGCAGTCGGTCGAGAAGGACGCGGTG
ATCGACGTGATCGGCGTGCTGCGCGACGTCGGCGAAGTGTCGTCGATCACGTCCAAGAGCTCGGGCAAGCCTTACGAGAA
GCGCGAGCTGACGCTGGTCGACGACAGCAGCTTCTCCGTCCGCACGACCATCTGGGGCAAGACAGCTGTGGCCTTTGACG
CCAAGCCCGAGTCGGTCATCGCCTTCAAGGGCGTGCGCGTGTCCGACTTTGGTGGCCGCTCGCTCTCGCTGCTGCAATCG
GGCGTCATGTCTATCGACCCAGACATCACCGAGGCCCACCACCTCAAGGGTTGGTACGATGCGGCCGGTCGGAGCGAGAA
CTTTTCCTCGCACAACAGCATGGGCGGCATGGGAGGCGGTGCTGGCAGCGGCCGGCCCGAGCAGGTCAAGACCATTGCCC
AGGTGCGCGACGAGAACATTGGCATGGACGAGACCGCCTACTTCACTCTCAAGGCCACCATCGTCTTCATCAAGCAGGAG
ACGTTTGCCTATCCGGCCTGCAGCTCCGACGGCTGCAGCAAAAAGGTCGTCAGCAGCAGCGACGGCACCTGGCGCTGCGA
GAAATGCGACATGAACCATCCCCAGGCTCTGTATCGCTACACCATGATGCTCAACGTCAACGACCATACCGGCCAGCTCT
GGCTGACCTGCTTCGACGACGTCGGCCGCATGATTATGGGCGGTCGCAGCGCTGACGAGCTAACCGAGCTGCGCGAGGAA
GACGACATCGCTTTCGGCGCCGAGTTTGAAAAGGCAAACTGTCGCAAGTACTCCTTCCGCGTCCGCGCAAAGATGGATAC
CTTTGGCGATGCTCAGCGGTATGTGTTTTGTGTGCTTGTGTTTTGTTCTCTTTCACTGACTCTTGCAGAATCCGCTACCA
AATTGTCAATGCCCATCCGCTCGACTTTAAGAGCGAGGGCCACAAGCTGGCCGAGCTCATCCATCAATTCTCTCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62