GenePrediction:GLEAN_7508 Details

Name: GLEAN_7508
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1608242..1606859 (- strand)
Length: 1384
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1608242..1608145 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_140:1608089..1606859 (- strand)
Length: 1231
>GLEAN_7508 class=GenePrediction position=GCSC_140:1608242..1606859 (- strand)
ATGCACTTGCCATCATCGACACTGGCATGGGGCCTTTTGGCTGGCGCAGCACATGCTCAAACACTGATAAATGAGCTCAG
CTTTGGGCACGATGGCCGGTACGGACCACTTTCATGAAAGCCACCAGGCTAGCAAATGCTGACATCCTCTCAGGATAGCC
CCGGAAAACTCCCGAACTATCCCCAACTTTGAGCTCGAGGGCAAGCCTCATATACCCGAGATTCTGTCGAACAAGCTCAT
CCTCACTCCTGCTGCCCCGGCGCCTGGCGGCCAGCGTGGTGCCGTCTGGTCCGACCGGAAGCTCGACGTCCCCACCTGGA
TAGCCGACGTCGACCTGCGCGTCAGCGGACCAGAGCGGGGAGGTGGCAACGTCAACATCTGGTTGGTGAAGGACGGACAA
TACGCAGTCGGAACGAGCAGCGTCTACACAGTCGGACGGTTCGAGGGCCTGGTGCTGGTACTGGACACATCTGGCCCGAC
TGGCACCGGAGCCCTGCGTGGCTACCTTAACGACGGCACCAAGGAATACAGAGCGCTCACCGGCATCGATGGCCTGGCGT
TTGGTCACTGCGAATACGCATACCGCAATTTGGGCCGGCCGTCGCAGATCAAGATCCGGCAGACGGAACGCTCCTTCCAG
GTGGATATTGACGACAAGCCGTGCTTCGGCAGCGATAGTATCGTCATTCCGATGGGCTACCACTTTGGTATCACGGCAGC
TTCTGCCGACAACCCGGACTCGGCCGAGATCTTTAAACTCGTTGTTCTGAAGACAGACTCCAACTCTCAGCAGCAGCAGC
AGCAGCAGCAGCAAGGTGGTGCAGCTAGCAAGGGCAAGACAGAGGGCACCGAGGTGTCTGGAGGCACTATAGGAGGGGAG
GAGTCTTTTGGCGAGGATATCCCGGACGCAGATCCCAGCGTGTACGCCAGCTCTGATGCGCAGTTTGCCGATCTACACAA
CCGGCTGCAGGACATCAACCACCACTTGACGATCATGTTCCATAAGATGGCTACCACCGACGCTGTGGGCGAGCATCGAC
ACGAGGAGATATCCATCCAGCTGGGCGCGCTCAAGGACTTGCTCTCGAGCATGAACGCCAAGCTGGACCGCCTGGGAATG
ATCGAGGCCAAGGTGGAAAAGATGGAGCGCGACATGAAGCAGCTGAACGTCGAGCTGCGCAAATCCATGTCCAACACCGA
AAAGTCACTCCTTACCCACGTGTCGGGCAATCTGGCCGGCCACCACGATAAGCTGGCCGAGGAGCTTCGGCACCCTGGCC
ACATGCGCCTGATCCTGGTCATCATCAGCGGCCAGATCTTCCTTGTTGTCTCCTACTTCATGTACAAGCGACACAAGGCG
AACTCGCCTAAGAAGTACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62