GenePrediction:GLEAN_7509 Details

Name: GLEAN_7509
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1602831..1601157 (- strand)
Length: 1675
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1602831..1602753 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:1602550..1602270 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_140:1602196..1601432 (- strand)
Length: 765
Type: CDS
Source: GLEAN
Position: GCSC_140:1601366..1601157 (- strand)
Length: 210
>GLEAN_7509 class=GenePrediction position=GCSC_140:1602831..1601157 (- strand)
ATGGCGGCAACAGATGGAGAAGCTGGCTTGGAGGCCTTCTTCGCGTTGATGCACAACGAGGGCGGCATCATTGTACAAGG
TGGGTGTTGGGGAAGCCATACACCCAATTGGTGCGACCCCAGAAGCAAAAGCAAATGCTGACCCCGATGCTGTTTTATCG
ATCGGCTAGAACCACCAAAGTTTGACTTGGAATCCTACATTCAGAACTACAAAGGCTTGCCTCCCACTCCCGGCTCCGCC
CAAGACATTCTGCAGCTTCTCCTCTAACGTGCTACCCGCAGGTGCATCACGATTTGAGCGACTCCTTCTGATCGGACAAT
GCTCCCCTTCGTTGTGCGTCGATTCACTCAAAGCCGCGGTGATTGAGGCGAAGAAGGGGAAGGATGTGCGTCGTTACCGA
GAGGCATGGAATTACATGCGGGTTGCAGCACCCAACGATGCTCTGGCACAGTTGGACAAGAAATGGATCGACGCCACCGA
GGCAGCCAACACAGCAGAGACCAAGCATCTCGAGAAAGAGCTGAAGGCCTATAAAAATAACCTGGTGAAGGAGAGCATTC
GGGTTGGTACCGCCTTCTGGGTCTTCCATGGCCCCATACATTTTCTGCCGTGTGCTGACCTAGCTACTCTACAAGATGGG
TCACGAAGAGCTAGGAAAGCATCTGCAATCGATCGGCGACCTTGCCGGAGCTGCCGAGGCATATAATCGCATGCGGCCAG
ACGTCAGCACGCCGAAGCACATTGTCGATGTTGGCAAGCACCTCGTCAGCGTGGCGATCGAGCGACGAGATTGGCCAGGA
GCAGTCGGGCATTTGAACAAGGTTACTGGATTGCAAGGAAGCGAGGAAGACAAGTCCTACTTGCCGTACTTGCGCTCCAT
GACTGGACTCGCCTATCTCGGCCAGTCTAAGTACCTGACAGCAGCTAAGCTGTTCCTAGAAGTTGAGAGCAGCGTTTCGA
TTGCCAAGGTGACCGGTGGAATGATGACGGGCAACGACGTCGCAGTATACGGCGGCTTGCTAGCACTCGCATCCATGGAC
CGGAAAGATCTCCAGACCAAGGTGCTAGAGAACTCTAGGTTTCGATCGTACCTAGAACTAGAACCGCACATCCGCCGAGC
CATTGCGCAATTTGTCAACGGTCGTTACGCTGCGTGCCTCTCGATCCTCGCATCCTACCGACCGGACTATCTGCTAGACC
TGTACCTGCAGAAGCATGTTAGCACCCTCTATGAGCAGATACGGGTCAAGTGCATTAGCCAGTACCTCATACCGTTCTCC
TGTGTCACTCTGGCAAGTATGGATGCGGCGTTTGCGGAGCCTGGCGGGTCCGTAGAAGAAGAGCTGGCTACTATGATTCG
TGATAGCGTCATTGATGCCCGCATCGACTCGATCAACAGGGTCAGTCTCTTTTCCTCCCACAATCTGCGGATGGACTTCT
TCGCTGACTATTGGCCTCGAATTAGCTGGTTGTTACGACCAAAGAAAACCCACGAGTCAAGATGCAGAGGCAAGGCTTGG
ACGCCTTTACCGCATTTAACAAGGAGGCAACTGAGCGGATTCGCAGGATGAGTCTTCTTGCTGCCGACCTCGGAGTAAAA
GGCCCCCGGAGGCAGCATGCCGCCATGCCCGATGTTTCCGATAGCTGGTATGAGTCTTCAGTCAACGAGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62