GenePrediction:GLEAN_750 Details

Name: GLEAN_750
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1873555..1875226 (+ strand)
Length: 1672
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1873555..1873645 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_97:1873869..1875226 (+ strand)
Length: 1358
>GLEAN_750 class=GenePrediction position=GCSC_97:1873555..1875226 (+ strand)
ATGCGCAACCGGTTCAAGAAATCCTCGCGCTCTACCTCCATCAGCTCTGCGCAATCCCCCAGCAACTCCCCACAGAAGCT
TGCCGTACCAGGTGTGTGATCCGAGACGCAGCAGAACCGTTGCTGGCACATTGTTTCTGTTCCATTCCGTCTGTTGTTTC
TGCTGCTCCTGCCATGTCATTTGTTTCCGGTCTCTGTTTCTGAAACCTCCATGTCTCTTCTCCGCCACACTCTTCATTCC
GTCCGTGGAAACGTGGCTTGTCTTTCTCAGCACATCGCATGTCGGCCGGCGACCCGTCTCTAACACTTGCATAGGCACCA
CCCAAACCCCGGCACCTTCCACACCAAATGACCTAGCGAAGCCGTCTCTGGTCAATGCCCCGCCGGCCTCTGTCAATACT
AGGACTATGGGCATAAGCAGTGGCCTAACTAGTGAAGAAAAGCGGCTCCCTACAACTCCGGCCCCAGCCAACGTCTCCCG
GAAACTATCCACCATTCGAACCGTAACGACTTCCGACGACGGACCCCGCGCTTCATCTGACGACGACCTGCCCTCCGACG
CCTCGGCATCCATCACACGCAACTCCAATTCAACCTTTTCTGGCTCTGAAAACAGCGCAACCAGCGCCGCATCCTCTGCA
TCCCACTCGCTACAGAACGACCGCAACATAACCCCCAGCAGTCGCCTAAACCAAAGTACACTCTCTGATTCCGACGACCC
TGTCATACGACCAGGAAGCCCGGAAGCAATGCCTGCGAGGTCCGAAGTGGATATTGAACACCGAGGAGACATTAGCTCGC
TAGCCGTCCCCGAACGATCCTTGACGCGGGTAATTTCAAACTCGAGCCTCAGCCAGGAAGGTGTTGCCATGACGGACGAT
CGACAGGGCGAGGGGGCTGGCGCCAATGGTTGGGACTCCACGGTTGGTAAGGCCGGCCTGGGCAAGACTGGCCGTGTGAT
CAATCGCCTGGTGTCGGACAATGAAACGCTCAAACGGGACCTGAAGCTCGAGAGCTTAAAGGCAGACGAATCCCGGCAGG
CCGCCAAGCTGCTAGAGGACAAGATGGAGAGAATGGTCTCCGAGTATGAGAGCCGCCTGCTGGAGGCCAGCGTCACCAAA
ACACTGCTGGCTCGCAAGGAACGTCAGGTCGAGAGTCTACAGGGCGTCGTCGAGCTGGAGAAACAGCGTGCTACCGATGC
TAAGGACCGGGAGCGCATTTGGAGAGAAGAGATGGACAAGGTCAAGAAGGAGTCAAAACAGCAGGTTGAGGAGGCCACCG
CCCACGCTGCACTGATGGAAGGCCGCTACAACGCCATCAGCAGCCACTGGCGTGACCAGGGCGATGCTGTAAAGCAGGCC
CTGGGCAGCATGGCCAAGGAAGTCAAGGAGCTGGCCGAGGCACGGCGGCAAGACGACGACAAGATCACAACACTCCGTGA
TCTGTGCGACCAGCAGGACGGTAACATCCGTCTATTGTGGCAGCAAAAGGAGGACATCACTCGCAAGTACGAGGCTTACA
AAAAGGAGCAGGAAGATGCGCTGCGTGACATCAAGGCCAATGCCGCCAAGCGCGAAGCCGAGCAAGAACAAATGCTAGAA
GAAGCCCGGCAGGTGCTTGACAAGCTGAGGTGGGCACTCAATGTCAAGAACAATGTTGCCTGGGCGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62