GenePrediction:GLEAN_7510 Details

Name: GLEAN_7510
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1598957..1598137 (- strand)
Length: 821
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1598957..1598878 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:1598809..1598137 (- strand)
Length: 673
>GLEAN_7510 class=GenePrediction position=GCSC_140:1598957..1598137 (- strand)
ATGGCTGCCACCAGCCTTGAGGGCCGCACGACCTGCCCTTTTCTGCTCAAGCTCTTCTACCGCACCGGGGCCTTTCACAG
GTGGGAGCGGGCCCTGCTGACCGCTTTCCTTATTACCGTTTGTTAACCGGAATACCTTCTTGCTTTAGGCTTGACGAGTT
CTCTACGCCCCAACTGCTGCCGTTTGTGCCCGTCTATGCTTTCCCGACATACAGCCTCGACGAGCTTGCCTGTCACCTGG
CTGGCGGTGAACAGGCCGTCTTACCGGCTCCTGCTGTCGGCACGCGCATTGCATTTCGTCTCGTATATGTCGACACGCGT
GGCGCCGCCGAAAGCGGAACTGAAGGCGGCGGTCCGGGAGGTCTCAGGCCAGGACCTATACGCTTTGCTGTTAGAGACCT
TGGCAGCGTGGTGATTGGGGGCGAAGGCTATGTTGCATTGGCGTCCCCCAACTCCGACGATGGACGCAAGACGCTTGCAG
ATGCCCGGTTTGTCGTTGGTGACTACATATCGTGCGCCATTCTGCCGCCACTGCCAGACGGTTCTGCTGCGCCAGCTTCT
ACTGCGCGCAGCGGCCGCGGATCCGGCGCTGGTGAGGGGCGGACTACCATGATGCCTCCAGGCGGTGGTGGTGATCGGCG
CGACGAGTTCCGGAGGTGGAAACGCGGAGGAGGAGCAGGTTCTGGTCCGAACGGAGGGCCGGGCGGAGGACCGGGCCTGT
GGACTGATCCTCGCGTCCCGGCTGGTGACTGGCGCCGTGGCGAAAGAGTGCCTGATGGGCCCTGGAGTCGAGGCGGTCGA
GGACGTGGTGGGCGATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62