GenePrediction:GLEAN_7511 Details

Name: GLEAN_7511
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1596971..1594030 (- strand)
Length: 2942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1596971..1596755 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_140:1596698..1596407 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_140:1596312..1595742 (- strand)
Length: 571
Type: CDS
Source: GLEAN
Position: GCSC_140:1595673..1594780 (- strand)
Length: 894
Type: CDS
Source: GLEAN
Position: GCSC_140:1594728..1594662 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:1594613..1594455 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_140:1594376..1594030 (- strand)
Length: 347
>GLEAN_7511 class=GenePrediction position=GCSC_140:1596971..1594030 (- strand)
ATGGCAGACACTTCTGTAGGCGTGCAGCTCTTCAGCCAGGGCGTCTTCAGCCCACCAGCTGATTCTGCAGACCTTGTTGC
GGCCTCTCCGGCGATCGACCTGACTGCAACCGCTGGAGGTGGCAATGCCGTGTACATCTGGAGGCGCGGCGGTGAGGTTG
TGTCTAAATTGTCTGAGAGAAACAAAAAAGTCCAGGCCGTCGCATGGAAGGCCGATGGTGAGTGGTTTGCATTCGATTGC
CGGCTTTTACTTGCTTTCTGACTCTGTCTACAGGCCAATTCCTTGCCATAGCCTGGAACGATGGTGTGGTGCGTCTGGTC
GGGTTGGAGAGCTCCAAAGCTGTCCATCTCATCCGCCTGTTTGAGGGCGAGCCGTCTACTGTTACCTTTATCAGCTGGTC
TAAGAATCTGGTTGGTATCCCTGAAACCTGGCAGGCCAAAGTCCTGGAAACCCTCGGCGAGGAGGACAATGATGCCATCT
TAGACTTGCCACGGACCTTGATGTTTCTGGAAGTCGAGGACGACCTGCCGAAACTGTTACCGCTGCCCGTGTCGGGTGGT
TTAGGGTAAGCAAAGCATGTACATGCCTCTTTCTCGCAGAAGGCCTTGGCTAAGATCAGGCACCATGACCAGAGATGATA
TGTTTGTATTTTCCACCAGGACGTCGCTTGAGGTCATGTTCCCTGCTCTTAAACCAAGCGAGGGTGGTGCCATTCATATC
ATGGTGTTAGGAACCGATGATGGGGGCATCCACGTCTGCATCTACGACACCTTTGTCATGGGCACCTTCAAAGTCCCGTT
GCCGCTCAGTTCGGGGACACATCCGGAGGCACAGCAGCCGCTGCTTCGACTTCGTGGACACGCTAACCATCCGGCCAGCT
CGACACACTCTCTGTTGCTGTCCAACGAAGACGCTGATGTGAATGCTGTTTACCTCATACCGATGGACTTCTCCTTCATC
TTCTCCTCGCCCCTGAACCTGTCGCTGCTCGATTATAAGGCCACTACGTTCCAGAAAATCCTCCGCTACATCAAACAGAC
CCAGATCCACATGCAGGGCGAATGGCAAGCCGCCAGAGAACTTCCCGCTCGATTCCTGGTCAGCATTCAAGAGGACCTAC
AACAAGAGCCTCGCTTCAAGACCATCGACCAAGCCCTGCGTGTTGCTGCGCTAACAGGCTACGTTCCTCCAGCCCTCAAG
TTGTGGCTCGTGGAAACCATCTCAGAGCGGGTAGGTCTTTCATCTCTTCTTCTCTCTGTCTTCTTTGATGCGTCCTTATT
TTGACACATGAACCATAGGGTCACAAGCGATGGGACAAAGCAGTCATGTCTGGACTGGAGAATCTCCGTGACCTCATCCA
CGAGAACATGATGCCGGCGCTCGATCGCGCAAGCCTGGCCCTGAGTCGTCTCCAAGGCTTGGCCGAGTTTCACAGCGACG
ACGACATTGGATTTACAGGAGATCAGATAGGGCGGCTCATAAACATGCTGTCTTGTCTGATTGTGGCATCGCACAATGCC
CTGGCTCTGGTGACGTCCGAGCTGGAGCTTTTTGTCATGTTCTCGGCCTGGCTACGGCTGCTGATTGAACGACTGGCGCT
GCCGGGCCAGGCGGAAGAGCAGGCCGAAAAGGAGCCGGTGATGAACGTAACGCCGGTATTGGACTATATCACGAACCACC
TCCTTTCGAGCCCGCTTGATCTACACTTCGGCAAAACCGCCACGGCAGATTGGGATGCCGACTGGAAGGCAATCGAATCG
AGCTCCGAGAACCTCATGGACAAGCTAGAGGCAGAACTGGAGAAAGTCGACAACATCGGGGTGGAGGATGGACTCTCACT
TATGCCCAAGAACGGAGCCCGGAAGCGGCGTGACGATAAAGCATCTGCAAAAGACGCCACAGAGAGACAAGGGAAACGAC
AGTCTGCAGACGGCTTACAGCTTAATGAGCCGGCCAACGAGGAAGACGATGGGCGCGAACCGGAAACGCAAGGGGGTCCC
GGAGTTGAGTACATGAAGGCATTCCCCAAATTCGAGTTCCTGACTAAGCTGCTTGCAACACATGCCGACCGGACTCTGAA
AGATATTGCCGAGTCTGGCAGACGCCACGTCCATTTTGGCCCTGTGACGCGACTAGATGTCGGGGCACCGGTGAAGCAAG
CAGAGGTTGCCATGAAGGCTGTGCTGAAAACTGTGAGTCGTCTGTCCCGTTTTACAATGTCAACCGTCTGCTCACAATCA
TAGGATCTGGAAGAGAGCGCGGACGTGTTGGCATTCACGGTGATCACCTCGGACGAAAGCACAAATGATTGTACGTATAA
GGCACAACCTCCAAGACGGAAGCTGACCGCTCCAATAGTCCGTCTTTTCCGCACTGCCATTTCCACGTCGGGTGGCATCA
GCACTGCTGTATCGACCCAGGTCTGTGCTGTTGCACTTGCTGGCAACGGCAGCATTACAGACATCCGCTTCCTTGGCGCA
GAGCTCATTCTTGTTTTGTGGACTTGGACGGCATCGGGTACGTGAAGCGCTAAAGTTCTTTATTCCCAACCCGACAACCC
GACAACTCGACCAGATGCACTGACTCGTTTTGCAGACCGGCCGCCACTTTTGGTCGCCATACCCGTACAATCACCAAGCA
TTCGGTACGAAAAGTATACCGAAGGAAGCACGGGCAGCACAGAGCCGCAGACGATCCAGCTGGACCACGGCACAGTCCGG
GAAGGAGGTGGCCTCACTTCCAGTGGTCTCTGCTGGGTGGCAGACCTCAGCAGCGCTGGCAGCTCTGGTCGCGTTGTCCG
CATGGAGGTGCTGGGTCCAAAGACTAGCGATGACGGAAGCGGCACGCCTGCAAGGGTTCAACTGCTATATGCAGACGGGG
CAACATATCGCGCCTTTGCGCTTCCGTCTGTGGCCGAGATGTTTGATGGCAGGTCAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62