GenePrediction:GLEAN_7513 Details

Name: GLEAN_7513
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1573153..1570339 (- strand)
Length: 2815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1573153..1571942 (- strand)
Length: 1212
Type: CDS
Source: GLEAN
Position: GCSC_140:1571746..1570431 (- strand)
Length: 1316
Type: CDS
Source: GLEAN
Position: GCSC_140:1570372..1570339 (- strand)
Length: 34
>GLEAN_7513 class=GenePrediction position=GCSC_140:1573153..1570339 (- strand)
ATGGACAGCCTTTTGCTTCGCGACGATGCGGCGCGCAACCGGGTTCGGCAGGCAGCCGAATTTCTCGATCCCAGCGACCA
GAATGTGCGCAGCTACCGGCCAGACATCATCGTGATGCTGCAGAAAAACCAACGGCGGCTGGTGGTCAACCTAGACCACG
TGCGCGATCACAACGCGGAGATGGCAGAGGGCCTGCTGATGCAGCCGTTTGACTTTACACTCGCGTTTAACCACGCGCTG
AAGCAGATCGTCAAGACGGTGCCGCAGGCGCGGGCAGAGCAGACGGACGACGAGGTGCCGTACTACTGCGCATGGGCGGG
CAGCTTTGGGCTGCACACATGCAATCCGCGGACGCTGTCGTCACAGCACCTGAACCAGATGGTGTCGATTGAAGGCATCG
TGACGCGGTGCTCGCTGATCCACCCAAAGGTAGTCAAGAGCGTGCACCACAGCGAGGTGGAGGACAAATTTTACTACCGG
GAGTACCGGGACCAGACGATGACGAACGGGGTGACGACGTCGAGCGCGTACCCGCAGCAGGACGAGAAGGGCAACGCGCT
GGTGACGGAGTACGGTCTGTCGACGTACCGGGACAACCAGACGGTGTCGATCCAGGAGATGCCGGAGCGAGCGCCGGCCG
GCCAGCTGCCACGTGGCGTGGACGTGATGCTGGACGACGACCTAGTGGATCGGGTCAAGCCGGGCGACCGGGTGCAGCTG
GTGGGCATTTTCCGGACGCTGGGCAACCGCAACACGAACCACAACAGCGCGCTGTTCAAGACGATGCTGCTGGCGAACAA
TGTGGTGCTGCTGTCGTCCAAAGCGGGCGGCGGGGTGGCGACAGTGGACATTACGGACACGGACCTGCGCAACATCAACA
AGGTGGCGAAGAAGAAGAACCTGTTTGAGCTGCTGTCGCAATCGCTGGCGCCGAGCATCTACGGGCACGACCACATCAAG
AAGGCGGTGCTGCTGATGCTGCTGGGCGGGGTGGAGAAGAACCTGGAGAACGGGACGCATCTGCGAGGCGACATTAACAT
CCTGATGGTAGGCGACCCGTCGACGGCCAAGTCGCAGATGCTACGGTTTGTGCTGAACACGGCGCCGCTGGCGATCGCGA
CGACGGGACGGGGATCGTCAGGCGTCGGTCTGACGGCAGCGGTGACGACGGACAAGGAGACGGGCGAGCGGCGACTAGAG
GCGGGCGCGATGGTGATGGCAGACCGGGGCGTGGTGTGCATCGACGAGTTTGACAAGATGTCGGACATTGACCGGGTGGC
GATTCACGAGGTGATGGAACAGCAGACGGTGACGATTGCCAAGGCCGGCATCCACACGTCGCTGAACGCGCGCTGCAGCG
TGGTGGCAGCGGCGAACCCGGTCTTTGGCCAGTACGATCCACACAAGGATCCGCACAAGAACATTGCGCTGCCGGACTCG
CTGCTCTCGCGTTTCGATCTGCTGTTTGTGGTGACGGACGACATCGAAGACGCACGTGACCGGCACATTTCAGAGCACGT
GCTTCGCATGCACCGGTACCGTCAGCCGGGTACGGAGGAAGGCGCGCCTGTGCGCGAGACGGGCGGCCAGTCGCTGGGTG
TGGGCATGCAGAGCCAGAGCGACGCAGCATCGCAGCGGCCGGTCGACGTGTACGAGAAGCACAACGACATGCTGCACTCG
GGGGCGCTGGCCGGGGCAGCAGCAGCGGGTGGGCGACGAGGCAGCGAGAGAGCAGCGAGCCGGAAGCGGGAACTGCTGAG
CATTCCGTTCTTGAAAAAGTACATCCAGTACGCCAAGACACGAGTGCGACCAGTGTTGACGCAAGAGGCGTCGGACCGGA
TCTCGGACATTTACGTGGCGCTGCGCAACGACGAGATGGAGGGCAACCAGCGACGAACGAGTCCGATGACGGTGCGGACG
CTGGAGACGCTGATCCGGCTGGCGACAGCACATGCCAAGTCGCGGCTGTCGAACCGGATCGAGGAGCGTGACGCAGCGGC
AGCCGAGGCGATCCTGCGCTTTGCGCTCTTCAAAGAGGTGGTGGAGGACGAGTCGCGGCGGAAGAAGCGCAAGACGCGGC
CGATGGAGGAAGATCGGTCGAGCAGTGACGAGGAAGAGGATGAGGATGAAAACGAAGATGGGGACGACGGGGGCGACGAT
GCGGACGATCGTCGGCGTGCCGGTGCGACAGCCTCGCGATCAACCCGAGCAGCAGCACGATCGGCGAGAGGGCAGGAAGC
AGTAGCAGCAGCAGCAGAAGAAGAAGAGGAGGACAGCGAGATGAGGACCGCAGCAGCGACGCCGCTTCGACGGTCTGGTC
GAAGCGGTGCGACGGCGACGACGACGTCACAGTCCAGCGTGTCGTTTGCGTCTTCGCTGCCGGCATCGCGTCTGGTCGGC
TCGCAGACAGAGACGTCGCAGGCACGAACAGACGAGGAGGAGGAGGAGGAGGATGAGCTGGCCAGCGGGGCGGCAGCACT
GCGCATCGGGACATCGACTGCAGGGACATCCGTTGCAGGGACACCGATCAGCGCTGCTCGGCTGGCGACATTCCGGCGCG
TCTTGGGACAGCTGCAGTCGACGAGCCTGTTCGAGAACGAGACGGCCGACGTGGACGCCATCGTGACGGCGGTCAACGGC
AAGGTCGGGTCACAGGGCGGCGCTTTTAGCCGCGAAGAGGCCGTCAAGGCGCTCGAGAAGATGGACAAGGACAACCAGAT
TATGTGAGTGGCTGGAGGCGTGGAGGTGGAGTGAAGTCGTGCTTTTGCTAACCAGGAACAGGTATCCGGGCGGGAATGTT
GTCTACCAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62