GenePrediction:GLEAN_7514 Details

Name: GLEAN_7514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1568102..1566273 (- strand)
Length: 1830
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1568102..1568044 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_140:1567982..1567359 (- strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_140:1567290..1566273 (- strand)
Length: 1018
>GLEAN_7514 class=GenePrediction position=GCSC_140:1568102..1566273 (- strand)
ATGCCTCTCGCCAACATGGCTACCAACAACATGCACAACCTGACGACGCTCATCAAACGGTGCGTTTCTGTCTTTCTGTC
TTACTGTTCTCTCGTCTCCCCCTGCTGACTGACTGCCCAGGCTCGAAGCTGCCACGGCCCGCCTCGAGGACATCGCCTCG
TCCACGATCGAGCTTCCCCAGGCCGTTCCTGGTCTCCAGGAGGGTGCTATGTCGGCTGCTCCGGCTCCCCCGATCGTCTC
GGTGGCTGCACCGACCCCGACAGCGACGGCTCCCCCACCAGCTCCAGCGCCGGCTGCGGCATCCGCACTGCCGGCCGAGG
AGCTCCCCGAGTCGATCGAGGACTTTGACGTCTTCCTTGCCGGCGCCGTGGCCAAGTTCGTCGACCTCAGCCGCAAGCAT
GGCGGCGTGGTGGCTGAGCAGGCCGACAAGGTGCTCGAGGGCTTCCGGGCCCAGCGCACCTTTCTCCTCATCTCCACCAA
GGCCAAGAAGCCCGACATGACCGGCTCCGAGATGTCTGTCTACCAGGACCTGCTCAAGCCCATCAACGAGGCCCTCATGG
CCGCCGTCAACATCAAGGACGCCAACCGCGGCTCGCCCGACTTCAATCAGCTCAGCGCCGTGTCCGAGGGCATCATGGTC
CTGGCCTGGGTCACCGTCGACAACCGGCCCTACAAGCACGTGGAGGAGTCGCTGGGGTCGGCCCAGTTCTTTGGCAACCG
GGTCTTGAAGGAGTTCAAGGAGAAGTGGGTTCTTTCCCCATCGCTTTCTGTCCTTCCTCTCAAACCTCCCCCCTCTTCTA
ACCTCACAACAGAGACCCTCTGCAGGTCGAATGGGTCCAGTCTTTCTACCAGGTCTTCCGCGACCTGACCGACTTCGTCA
AGCAGCACTTTTCCGGCGGCCTGTCGTGGAATCCCCAGGGCGCGTCGGCCGTCCAGGTGGCCCAGCAGCTGACGTCTGCC
ACCGACTCTGCGGCTGCACCGCCTCCACCGGCCCCTTCGTCGGGCGGTCCGCCACCACCGCCGCCACCACCGCCGCCAGG
CCCGCCGCCCATGCTGCAGATCAAGACCGAGTCGGCGCCGGCGGCGAGCAGGAGCAGCACGACCGCGCACGGGGCTGTGT
TTGCGGAGCTCAACAAGGGCGAGGCCGTCACGGCCGGACTGCGCAAAGTGGACCGATCACAGATGACGCACAAGAACCCG
TCGCTGCGTGCTGGCTCGACGGTGCCGGACGGCAGCACAGCCGCTCTCCGGGGCAAGAGCCCGGTGCCGGGCAAGAAACC
CAAGCCTGAGAGCATGCGGGTCAAGAAGCCGGCGCGCAAGGAGCTGGACGGCAACAAGTGGACGATCGAGAACTACGATC
GCGAGGCGGCCGCAGCAGCCGGTGGCCCGATCGAGATTGATGCCTCCATCGGCCAGTCGATCCTCATCAGCAAGACCGCC
AACACCACCGTCATCATCCATGGCAAGGCCAACGCCGTCACCATCGAAAACACTAGCCGGCTCTCGCTCGTGCTCGACTC
GCTCGTCTCGTCTGTCGACGTCGTCAAGTCCCAGAATCTCGCCCTGCAGGTCCTCGGTTCTATTCCTACCGTCATGCTCG
ATCAGGTCGATGGCGCCCAGATCTACCTCAGCCGCGAAAGCACCGCCACCCAGGTCGTCATGAGCAAGACCGATGGCGTC
AACCTCAATGTCCTTCCCGCCACCACCGACGACGACCCCGACGGCGAAAATGCCGACTACAAAGAGGTGCCCCTGCCCTC
TCAGATCTGCTCCTACTTTGACCCAGCCAAGGGCACCTTGGTTAGCGAGATCATTGCGCACGCTGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62