GenePrediction:GLEAN_751 Details

Name: GLEAN_751
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1876297..1878937 (+ strand)
Length: 2641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1876297..1876938 (+ strand)
Length: 642
Type: CDS
Source: GLEAN
Position: GCSC_97:1877006..1878937 (+ strand)
Length: 1932
>GLEAN_751 class=GenePrediction position=GCSC_97:1876297..1878937 (+ strand)
ATGGACGACTCCGTTGATATCTACTTGACCAGCGTGTGGAAGTACGAGGATGCTGGAGTCGAGCGTGTTCTCGCGGAATT
GCGAAAACAGACCCCTCAAGGCCAATTCGAATTCGAGCCAGAAGCTGGGTGGTTCAAGGCAACCTGTCCAGCCAGCAAAG
TAGCTGACGTGCAAGCTCATTTTCGCACAATCCATACAGAGATCGAAAGAGATTTACAAACCCAGGATGGGGCCAAGGTA
ATTGCTTCTCTCCTCCAGACCCTCGTGGTCCACGCGCTATCCTTACTTACCTCCATCATCTACGTTCAGATACCTCTTGA
CAGCAAATGGTTGAAGGTGCCGAGTCCCGGAGAGTTGCCTGCCCAATCCAACACGGAGAAAAAAGCTATCATAGACTACC
AGTGTCCCGTACGATTCGACAACTATAACTACACTCAAGTGTGGAAGCGCGTGAAGGAAGAAACACCAGACGCAATCACG
ATTCATACGTTTCTCAGCGCACAAGACATGGCAACCATCTCAGAGTCATCGGGCGTATTCATCCAGTGCGATTCTACTGA
CCGGCTGGCGTACCTCGGAGGTCCATCTAAGCAGAGTCTGAGCCAAGCGAGCACGATGCTTGATAACATGTTCCGCCGAT
ATGTCCGTGTGCCCTGTATATACCACTGTCAGTTTGCGATCAAACAACAAAAAGCTAATGGTTCTCTAGGCACATACCAT
GCCGCCCCCCAAGCACCTGTTGCATGCCGAAACAGAAGGAATACATCACGTTGATGTGAGGTACATGGCCCATGTCAACG
AAGCCATGCTTACATCGACTATACTGGATCCCGGGCATTTTCCCGGCAACAAGATGAATACCATGTTTGAAGCCATCTTC
TCCAAGGCTGTCTGTCTTCGAATCTGTATATTCGATCCCTTCAAACGAACCGAGGTCTCCTTCTTTGGCCCAAGGGTGAA
GCCGCTCTTCCATGACCAGGCACACAAGTCGCCGAGCTGGCTCAAAGATGAGGAGTATGCACCGAAAGCTCTGGGCGTGA
CGGCCCCAAGCGAATTGCCATCCACCAATGAGCCTGACAAGTCTCAGACACCACCCAAGGACTCTGAAGCGAACGGGTGG
GAAAAACAGCTCGACCTTCTCTCATTGGAGAGCAAAGACTTGGAAAAGATGGCCGAGGCAACCAATGGCCGTCCGGCATT
GAAGCCTGCATCTCTGGCGCCACCGCCAGAGAACGGGAAATACGGCTATCAGATGCGACTGCTATGGGAATTCGTCAACA
ACCCAGTTCCTGGGCCTAAAACTGATGCTTCCAAGTCCAGTAAACTCATCACCACGCTGGACGACGACAACAGAGAAAAC
ACACTCATAGATATAGGCACAGACGAAACAACGCCGTCGGTGGCCAAATCAGTTGAAGATGGGTCAAGACAGGGAGACCA
ACCGCTCATCGACCTTCCCGTACAGGCCCTTTCTGTCGGCAAATCCAGCAGCGGCTTTTCCTCCACTCTTTCGAGAAAGC
TCTGTCGCCAAATCAAGTTATTGACAGCAGACCTCCCTTATTGCAGAGGCCGCGTACAGATGCACGCGGCGCTGGGCCGC
ATCTACATGATGGATGCCAACCCGAGTGGACTTGCCACAAATGGCCCTGGCGAGCGAGCGTCTGGATGGGCCCCTACGGA
CATTGTGACCCGACTGGATACGGTATGCGTGTCCCCCGGGAGCGTCATGTTTACCAAGGCACTATCGATCTTTGCAAACG
ATATCGAAAATGTCGTTGGGACCGGAACATCGAATCCGCTGTGGACTTTCAAAGAGAAGCGCGTGATTTACGAGTTTAAG
TGCCAGCGATTTTCCTTCACGAGCGATGGGGTGCCGAGAGCACATAACCCTTTTGTTGTCGAGATCGATGGCACTCGGCC
GGGTGCATTCACTTACAACATGCGCCGCCTCGAAGATGCGCGCCCGCCAATATGGGTGCACTGCATCCGGCGGCACTGGG
ATGTCCGAATCGCGGTTATGTACAGCCCGACAGAAAAGCTAGAGAAAATGTACGGCGACTTTGCGCAGGGGCTTCTGCGG
TCGATGGTAGTTCCGCCAGGACCCATTGGGCCCGGGACAGGGCCTCGGTTCCAGGTCGGTTACGATTACCGGGAGATGTC
AGCTACAACGGGGCCTCGGTTCTGCACCAAGATTTTGAACGCGCGCGTTCGCCACGTGGGACGCCATGTCAGCAGGGATG
GAGAAAGCTTCTTGGACGTGTCGTGGAACCGGCACATGAAGCTCGAGACAAAGCCAGACAACAGCGACAGCCGGATGGGA
ATTCTGCGGGCAACGGCAGCAGCAGATGACCCGGTACATGGCGTGTTTGGATCATGGTACGAAGCCAGCGTGCTCTCGGT
ACGGGCGGAGGAAGCATTCCGGGAAAACGAGACACTGGGGGTGGGTGGGGCGGCAGCGTGGACCAGCTCGGCGATGCAGG
AGAGCATGTCCAGAGCCATGTTTGAGCCGGCACTGGATCTTGTCGAAAAGATGGACGGTGTGGGCGTGCTCATTGACAAC
GGACAGGGCGACACGATGTGGACGCCACCGGCCAATCAGATGAACATGGCTCTGGTGCCGGCTTCGGGGCGGTTCTGGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62