GenePrediction:GLEAN_7520 Details

Name: GLEAN_7520
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1539711..1538787 (- strand)
Length: 925
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1539711..1539516 (- strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:1539436..1538993 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_140:1538935..1538787 (- strand)
Length: 149
>GLEAN_7520 class=GenePrediction position=GCSC_140:1539711..1538787 (- strand)
ATGAAGTTCTCTATCACCGCCGCTCTTGCGTCTCTAGCCGCTGCCGCCAACGCCAAGGTTGCCTTCACCAATGCGAATTT
TGTCGTCACGCCTGGCAAGCCCTTCACCCTGACGTGGTCTGGCAATACTGGCGATGTCACCATCGTCTTCGCCACGGGCG
CGTTCACCGACCTGACGCCGGTTGAGACCATTGACAGTAAGGCGTTTTCTTGTTTGATTGCTGTTAGCAGTGCAATGTAC
ACCAGATGGACTGACATGGTGTCTCCAACACACAGAGGGCGACTCTGGCTCAAGCTTCACATGGACGTGCCCGGCCGACA
TCACGAGTGGCGTGTATGCCTTTGAGATCACGGACTCGGAGACGACCAACTACAGCGTGCAGTTCAGCCTTTTCGGCACG
ACGTCGTCTAGCAGTGCCGCCCCGGTCAGCTCTGCTGCCGCCACCAGCACCGCATCCAAGACCAGCGCGTCTTCTTCTGC
CTCGTCGTCGGCCAAGACTTCGTCGTCGGCTTCCGTCTCGTCGGCCCCTGCCTCGTCGGCCCCTGCCTCATCGGCTGAGG
CTTCGTCGGCTCCGGCTTCGTCTTCTGCTCCTTCATCTTCGGCATCGTCTTCGGCATCGTCTTCTGCGTCGTCTTCTGCC
TCTTCGTCGACCAACTCCACTTCGTCGCACTCGGCGACCAAGACGAGCTCTTCGAGCACCACCCTGAGCACCAGCAAGAG
TAAGCAGTCATCCATACCTAGGTCACACTGCAAATCAAGCAACTAACCCAAAGCAGCCACGTCCACGGCGAGCAAGACGA
GCGCTACCGCTTCGGCTTCTGCTACCGGTACCTCCGCTCCGGCCAACACCAACAGCGGCATGAAGGAGAAGTCCCCTCTG
GCCTTCATCCTCGTCACCGTTGCTGCCCTGATGTACTTCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62