GenePrediction:GLEAN_7521 Details

Name: GLEAN_7521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1535661..1534654 (- strand)
Length: 1008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1535661..1535262 (- strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_140:1535207..1535059 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:1534974..1534654 (- strand)
Length: 321
>GLEAN_7521 class=GenePrediction position=GCSC_140:1535661..1534654 (- strand)
ATGGCCGCACTCCGCTCCTCCACAATGCGCTTCCTGGCCGCATCCTCCTCTTCACGGTCACTGCTGTCTGTCCTGCGGCC
GACGCTGGCCGCGGCTGCATCCCCGTCTTCCGTATTTTCACAATCTGTGCGCTCCATGGCATCTGTCAGCACCGACGAGC
CGGCTCCCCTGATCAAGACGTTCCAAATCTACCGCTGGAGTCCTGACAAGCCGACGGAGAAGCCGCACATGGAGACGTAC
TCGCTCGACCTCAACAAGACCGGTCCCATGATGCTGGACGCGCTCATTCGCATCAAGAACGAGCAGGACTCGTCCCTGAC
CTTCCGGCGTAGCTGCCGCGAGGGCATCTGCGGCAGCTGTGCCATGAACATCAACGGCGTGAACACGCTGGCCTGCCTGT
GTGCGTCTCTGCGTCTTCTTCTCTCGCGCCGTGCATTCTAACAGCTTCCTACAGGCCGTATCCCAAGAGACACGACTGAG
GCCAAGGTCTACCCGCTGCCGCACACCTACGTGGTCAAGGACCTCGTGCCTGACTTGACGCACCTGTACAAGCAGTACAA
GTCTATCAAGCCATACCTCCAGAGGACCACGCCTGCTCCTGATGTACGTGATCACCACCCAATATAGAGGGCCGAACCAA
TCGCCGGACGCCCATCTTTTCCCAGCTGACAAGTGAAATCTTTTCAGGGCAAGGAGTACCTCCAGTCCAAGGAGGACCGC
AAGAAGCTGGACGGCCTGTACGAGTGCATTCTCTGCTTCTGCTGCTCGACATCGTGCCCGTCCTACTGGTGGAACTCGGA
AGAGTACCTGGGTCCCGCCATCCTGCTGCAGTCATACCGGTGGCTGGCCGATTCGCGTGACGAGAAGAAGGCTGAGCGCC
TGCAGTATTTCCAGAACTCGATGAGCCTGTACCGGTGCCACACCATTCTCAACTGCACTCGGACATGTCCTAAGGGCCTG
AACCCCGGCCGCGCCATTGCCGAGATCAAGAAGCAGATGTCCTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62