GenePrediction:GLEAN_7522 Details

Name: GLEAN_7522
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1524938..1523270 (- strand)
Length: 1669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1524938..1524869 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:1524821..1523898 (- strand)
Length: 924
Type: CDS
Source: GLEAN
Position: GCSC_140:1523832..1523270 (- strand)
Length: 563
>GLEAN_7522 class=GenePrediction position=GCSC_140:1524938..1523270 (- strand)
ATGTCGTATCCATGGGTCGGCGCGCCGGCCGTCTTCAACGGCACCAACGCCGAGACCGGCGGCGATTCCAGTGCGTCCTC
TTGCTGCCTACCCCCGGCTGCTGCTAACAATGCGCAGCAACCGAGAACCTGAACCAATGGTATCAATCGGGCGACCAGGC
GTTCATCATCGTGGCATCATGCATGGTCCTCATCATGGTACCAGGCATTGCCTTTCTTTACTCGGGGTTGGCACGGCGCA
AGTCGGCCCTGTCGTTGATATGGGTGTGCATGATGTCCTTCAGCGTGATCGTGTTCCAGTGGTACTTCTGGGGCTACTCG
CTGGCCTTTAGCAGCACCGCGACCAACGGCTTCATCGGCAACTTGCACCACTTCGGCCTGCGCAACACGCTCGCTACACC
GTCGCCCGGCTCACCGCTGATCCCAGAGCTGCTGTACTCCTTCTGCCAGATGCAGTTCTGTGCCGTGACAGTCGCCCTCG
TTGTCGGTGCCACGGCTGAGCGTGGCCGCGTGGTGCCAGCCATGGTGTTTTCCTTTTTCTGGGCCACCATCGTCTACTGC
CCCATCGCCTGCTGGGCCTGGAACGTCAATGGCTGGGCCTTTAAATACGGCGTCCTCGATTACGCTGGCGGTGGCCCCGT
CGAGATCGGCTCCGGCGCCTCTGCACTTGCCTATTCTTGGGTGCTTGGTCGTCGCAACGAGAAGATGATGCTCAACTTCC
GCCCCCACAACATCTCCCTCATCACCCTCGGCACCACCCTGTTGTGGTTCGGCTGGCTAGGTTTCAACGGCGGCTCTGCC
TTTGGCGCCAATCTGCGTGCCACTATGGCCTGCTGGAACTCGTGTTTGACCGCCATGTTCGCCGCCATGACCTGGTGTCT
GCTCGACTTCCGCCTCGCCCGCAAGTGGTCGCTGGTCGGCTGGTGCTCCGGCACCATCTCCGGCCTCGTGTCTGCCACAC
CCGCCTCGGGCTATATCCCACCGTGGGCGAGCATCATCCTCGGAGTCATCACGGGGATTTCCTGCAACTTTGCCACCAAG
GGTACTGTTCTATCTTTCCTTGCCCCTCCGCTCAATGCTCTTTTGTGCTCTTTCCTGACAGCTCAGTCAAATTCTTCCTC
CGCATCGACGACTCCCTCGACATCTTCGCTGAGCATGGTGTCGGTGGCATGGTTGGCCTCTTGTTTAACGGCTTCTTCGC
TGCTGACTACATCATCGGCCTCGACGGCGTCAACACGGGCCTCGTCTCCGGCGGCTTCCTCAACCGCCATTGGCGCCAGC
TCTATGTCCAGATCGCCTATCTCGTCGCGTGCTCCGCATACGCCTTCACCGTGTCTGCCATTCTGGCCAAGATCATCGAC
CTCATTCCTGGCCTGCATCTGCGCGCCTCCGAAGAGGCCGAGCTGTTGGGCATGGACGATGATCAGCATGGCGAGTTTGC
CTACGACTACGTCGAGGTCCGTCGCGACTACCTCGCCTGGACCCCTGCCGAGAGGGACCCCAAGCCAAATGGCGCGCGCA
TGGTACCGCAGCATGGCATCGAGGGCCACCAGTTGCTCATGACGAACGGCCAACCGCCACAGGACTCTCAGGTCTCACAT
CCGCCGTCTCGTGCATCGCCAGACCCCGTTTTCGGCCCTAGGGAGCGCGGGAATCGTGAGAAACCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62