GenePrediction:GLEAN_7523 Details

Name: GLEAN_7523
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1512745..1511220 (- strand)
Length: 1526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1512745..1512665 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:1512534..1511656 (- strand)
Length: 879
Type: CDS
Source: GLEAN
Position: GCSC_140:1511312..1511220 (- strand)
Length: 93
>GLEAN_7523 class=GenePrediction position=GCSC_140:1512745..1511220 (- strand)
ATGGAAGCGAAACGGAAGAGTCACAACCAAGTGCCAGGCCACCGGCGGCCCGGCGTGGTCCTTTTAAAGATCAAAAGGAG
CGTGAGAAGACAGCCCAGACCAGAAAATATGGTAGCTGTATTCGGTGCCGGATGCAACGTATACGGGTAAGTCACTACCC
TTTTTCTCCGGCGGTAACAATGGCAGGAAGCAGACGTAGCTAACAGAACAGTGTAACGCCCAGGAGGGAGACTATCATGG
CGAATGCATGGGCTGCAAGAAATCCTTGGGCAGGACGTGGCGGCTCCCATGTCTGCGTCTCAAGATCGGCGATGTGGAGC
TCTCAAAACCATGCCAAGTCAAGGGTCATGAATGGACGCTCCGTTGGAAAGAAAATTCAGTCCTGAATGATATTGGTGGT
TGGGCTTCATCTGAAGTCAGAGTCATCAGGCTCACTGAAGGCTATACTGATGATTTTGTGGAGTTCCGAGTGCGAGAATT
TATACCCAAGGCAGGGGATAGCCTGAGGCGCTCATGGATGACGCCTACGGGGGAAGTGCGATCTGTCGACATTCCGGCCT
ACGCCATCGTTGATACCGACACCATCGTGCCTCAGTACAAGGCGTATATTAAAAAAGGCTTGACGAAATGCTGCCACCGC
GTACTAGATGAGCACAAGGGAAAGCTTATCTGGTGGACATATAGTGATGCACTGAGACTGTCACGGTTGCCTTCACCTCT
GTCAGTTGAAGAACGGAAAGTGCTTTCGGACACGCTGGAGCTGTGGATGGCAGTTCGGCTGACAACGAGGTCCTTCGAAA
TTGTCGGCCCAGAGACGCTCGGGATGCCGCCCAACATTTTCGATGAAACGAATCCGTCTTGCGGGAAAATACCCATCCCA
CCTGTTATGGGGGCCCAGCTTGACTCCAGCCTGATTCACGAGATCCAATTCCGGTCTCGCCGAACGGCCCTAGAAGGGCT
GCACAAACTCATAACTGAGAACAAGGCCAAAAGCTGGCTTACCACATATCTCATCATCTTCATCCTCCTCCATAACACGG
CGCTTCTGATGAAGCACGACGCCAGCTATGCCAGGAAGCACGGAATGAATGTAAGCGTCCTTTCTTTAGCCGTCTGTCGA
CTGTTCCTTACTGACTATCGACCAATTTATCAGAGGCGATTCGCAAGACGGGAGAAAGTTCAACAATACTATATGGGGGC
GACCACACTTCTTGCATATTTTCACTATTGCAACAAGGGCGCTTTTCCCTTCTCGGATGACATCAAAGACGACGATATTC
GAAATCTTACGAATTTGGATGAGGAGAGCATACAGTGTATCTATCGGACGCGAAGCTATGTCATTTCTAAGAGTGAGCGC
GTTCTCTCTGCAAGGGCGTGCTGGCCTAGAAACGTGTGTGACGCTAACGCGACGAGCAGGAAAAGAGTGGCAGGATCTGC
GGGATTCCAACGCTTACGAAGACGACTTTTACTTTGTCAGTCAACTTTACGAGGTCAACTGGCAGCCTCGCAGTATGGCC
ATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62