GenePrediction:GLEAN_7525 Details

Name: GLEAN_7525
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1496455..1494421 (- strand)
Length: 2035
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1496455..1496371 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_140:1496254..1496049 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_140:1495985..1495215 (- strand)
Length: 771
Type: CDS
Source: GLEAN
Position: GCSC_140:1495161..1495014 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_140:1494785..1494421 (- strand)
Length: 365
>GLEAN_7525 class=GenePrediction position=GCSC_140:1496455..1494421 (- strand)
ATGGACCACACTTTCGCTCTCGCTGAGAGGGCGGCATGCATTTCACCCTTCTTGCTGGCGTCCGACTTTGAATCCACCAC
AGGCTGTAAGTCGACCGAAGCGTGCTCCCATTCCAAGCCAGCCAGCCAGCCCGGTATCTAACTCGTCCCCCATCCACCCC
GAATGTAGATACCAACGGACGATTGTGCTCTAACCTGACAGGCGTGTCGTGCTGTCTGCCATGCCCGTTCACCGACTGGG
TGTACCCAGAAAACTTCAACCAGCTGACAGCTGCAGCCGAGTGGATTGCCGTCATCAGCACCATCTGCTGTGTTGCGCTG
CTGCTGTCATGGGCTATGCTTCCAGTAGAGAAGACGCACCGGCACTATCTCAGCATCTGCCTGACGACCGGCGTGCTTTT
GTTGAGCGTACGTTGGTGTTCCGTGGCTCTCCCAGCTCTCCATCGGTTGGAATCCTGACTGACAGTACAGCTCGGCTTTG
TCATCCCGCTGGCGGGCCATCCAGAGCAGTGTGCCGACCCAATCACACCCAACAGCATACAGTCCAGCAGTATATGCGGT
GCGTCCGGCCTCATTCTCATTCTCGGCGGCTGGTCCAGCGTGGTGTGGGTGTTTCTGCGGTCCATGTCTCTGCACCTGCA
GATCTGCTGGCAGGTGGTCGTGGGCCGTAGCTTCATGTGGTTTGCCCTGGCAGCGGGCTGGGGCATCCCGATTCTGGGCA
CCATCCTGGCTGCCGTCCTCAGCGGTGTTTCATTCCGTCTGGGCGCGACCTGTCACATCAACCACAAGAACAGCCTGGGA
GACCTGTGGATTCCGTTGCTCGTATTTGCTGGCCTGGCCATTATCATCCAGCTCTTCACCTTTGCCTACTGCATCAAGGT
GTACCTGGCGTCGCTGTCGGACAACGCGGCCTCGACGGAAGGTTCGGGCCTGCCGTCGTATACCAACAGTATCCGCACGA
TGACGCCGCGTCAGGCGTACCGTCGAGTGCGCCGCGTCATCCAGCTGCAGTGGCGGGGTATCGCGATTGTGCTCATTATC
TGTGTCGACGTCATCTTCTTCAGCGTCGTCTTTGTCTTCCAGGACAACACGGTGGTCCGCCTGGCACACAAGCCGTCCAT
TGCGGTCGACTGGCTGGTGTGCCTGGTCGAGAACGAGGGCAAGAAGGATCCCTGTCTATACCTGGCAGGGTCGCTCACGG
TGAAGAAGTCGACCGTCGGTGCTGTTCTCATACTGTTGGCAGTAAGCACGACCCTGCCTCCGAGCCCCTGGCTGGCACTG
ACCTCTCTCTCTAGATGAACGGCTTGTGGCTGGTAGTCCTGCTGGGCCGTTGGTCCATTGTAACCGGCTGGGCGGAGCTG
TTCAGGCCAGCTGCGTACCAGAACAAGCAGCGCGAATTCGTCTCCGTTGACGCACGGCTCGATGACCTCAAAAAAGACAC
ACGTTCGTACGAGATGCTTTCTCGGGGTGCTTCCTCGGCGGGGTATCCCATGGCAAAGGACAATGGCATAATAACCACCA
TCGATCCTACCACAGGCTCAGCACCAGCATCGGCACCAGCACCAGCATCGGCACCAGCACCAGCATCGGCACCAGCACCA
GCATCGGCACCAGCACCAGCATCGGCACCAGCATCGGCATGGAAGATGTCCAGGTCGACAGACAGCCCAGACTCGCCTAC
ACCGTTGGTGGGCATGGGCGCTCTGGCCAGCCTAGGAGAAGAAGGCAGTTCGGCAGCCACTGCTTCGGCCCGTGTGGAGC
GTTCTACCAGCATCACGGGCGGCTCCAGCGGTCGGCGCACGCCGGACTATTTCAATCGGGCAGCCCGCTACAATGCGCCG
TCGCGGTCGTCCTCGAATTCGCGACCACTAAACACATCGCTGTCGTCTATCCGGTGGGACGCACAGGAGACGTTTGCGCC
GTCAAGGACGGCAAGATCGCCACCACCGCGAACACACACGACGCGTAGTCCCAGTCAAGACGCGTCGCAAGCCGAACTCG
ACAACCGGCATCCGCTGGGTATGAATCGGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62