GenePrediction:GLEAN_7527 Details

Name: GLEAN_7527
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1492083..1489148 (- strand)
Length: 2936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1492083..1490399 (- strand)
Length: 1685
Type: CDS
Source: GLEAN
Position: GCSC_140:1490336..1489148 (- strand)
Length: 1189
>GLEAN_7527 class=GenePrediction position=GCSC_140:1492083..1489148 (- strand)
ATGGCCAGCCAGGTGCCGGGGGAACTGGCCTTTGCCGGGCCTGGCGAGCCGTATAGGATTTCGCACGCCTCGTCCCGTCC
GACAGGCGATGTCGAGTGTGTCTGGGTCAACGCGTCCTGCGGCGTGCAGACGTTGCAAAGCAGGGTATGCTATGTCTCTT
GTAGTTTCTCTCCCTCCGAGTCGCCTCCTGACAGTTTTCAGTTTGGCTCCGCTGCCAGGGAAGTGATATACTCCAGATTG
GAGAAGTACATGGACTTTGAGGACGAGAACGAAGGGAGTGGTGACAACGAAAACTGGGATGGTGAGGACGAATCTGAGGA
GGATGAAGCCAGTGAATACGATGAGGATGAGGACGAACACCAGTATGACAACGATAGTAGCGAAGACGACCACGAATACG
ATCACGACAGCGGAAATGAAAGTGCTGCCCATAACGACGAAGATTACGACAGCAGTGAGACGGATGGAATGGCGGACGGC
CTCTTGCAAAATCAAGGCATCACAGGAGGCACGAGCAACGCTTTGATGAACGACCTTGCGACCCAGACCAATCAGCCGAG
CACGCAGAACACGCAGAACACGCAGAACACGCAGTTGATGCAAAGCTCAGTACACACCGTGTTTGACGGCCTGGGAACCC
ATGTGGCTACCGGTACTGCCTATATCGGCCTCGTATCTGCTGCCATGGCTAATGCTCTGTCGGGACACGTCGACATGGCT
GGCCCCGGTGACCCGGGTGGCCCCGGTGGCCCCAGTCAGACGGTGCCTCTGAAGGAGTCGGTGCCTCTGCACGGCACCAA
CATCCCACGCGTTGCCCGCGCGCGAGTGAACCTGACCGCCCTGTCCCAGCGGTACAACGTATGTGTTCCTGTCGTCAAAG
CGTCGGTCTGCCTGCTTGCTGCTAACCAGACCACCCAGCTCTACTTTGCCGTGTACCAGGACAAGATCCACGTCTACCGG
CCACAGCCAGCTCCCGAGATCCTGCGCGGCCCCCAGCTGATCCTCTGTCCGGGACCCAGCAGCGCCGCCCGGACCATTGG
TGGCTACATCGACCCCAAGTTCCCCCACCAGGCGAACCACGCCATCGTTGGCAATCTGGGAAGCCAGGAGATCCTCCTGC
TGGGCTACGACGACGGCGACGTCATCGCCTACTACACCCACCACATCCGCGACTACCTCGAACGCCGCTCACGCCGTCCG
CGACGTCGACAGCAGCAGCAGCAGCAGCCACTCAAGAAGCCCAAGCCCTTCTTCCACCAGACTGTCGGCATGTCCGCCTG
GGGCCTGGCCATCCATGCCCAGTCGCGCCTGATCGCCGTCAGCTCCAACCTATATGAGGTCAACGTTTTTGCCTTTGCTC
TCTATCCGCCGTCACCGTCTCGCTCTGCCGGCTCTACCGGTCGCTTGGGCGTGTTCCATCGGCCACCGGCCGCGTCCGCC
GACGGCAGGCCGACGTCCGACCTGGAGCTGCTCCGTCTGCTCCACCTGCGTGATCGCAACTGGCGCATTCTCCTCCCTCT
CGGGCTTTCCGGCCACAACATGCCGGGCATTGCCTTTATTGACGACGCCAACGGGGATGCCGAAAAAGTGATCGGAGTGG
ATATCCACGGTAATGCCTGGTTCCTCGATCTCTGGAAAGTCGGAGTGAACCGAGCTCTCGTCATTCTTCCTCCGGTTCGG
GGCGAGTGCGTTGTCCCCTCCCTTCTGCGCTCGGCAGTCCCATGCTAACACCATGTACCCCCTACAGTCGGCCCATTGGC
TGGGGAATTCTACCTCTTCCCGCAAAGGCGTTTGTTAAGTCGAAGCGAATGCCGCCCATGTCACTAGCAGGTGCCTCTGC
CGCAGGCTCTTTGGGCATTCCAGATCTCCTAAACTTCACAGGCGATAATGACCTCTCCTGTCCGGAAAATTTCCAGAGAC
TTGCCACCGACAGCCAAGCTAACAAGGAAGCTGAAGGGGAGCAAGAATCTGACGACGAGAGTTGGGGGGAGGACAGCTCG
GATGAACACGACTCGGTTTTGCCTGTGGACACTTATACGTCCTTCTCCGGCGGAGGGTACAAGGATGGGTCTGAATATGA
CTCCGGTAACGGACAGGGAAGCTGCACAACCGTCAGCAGCAGCAGAAGCAGCAGTGGCAACACGCCCAGTCACCACCGAC
ACAACCACGGGCGCTACGGTTCAGAGGAGCAGCATCACAGTCACGACTTCCAACTCGGATCGGTGATCTGTCCCAGCCTA
TCGCTGGCATGGCCCGACCTCTCGATGACGAAACTGGTCACCATCCTCCGGTGTGCGCCGCAGAGACAGAGGCAAGTCAA
GGACTTGATGCTCACGGGATCAGAGAAGATACCGGAGCTACTGCAGATGGCAAAGCGGCTGTCGATCCTGCGGACCTTTG
GCTTAGAGGCAGATCTGTTCACCACAGGCATGGAGAAGGCGTGGGGCGTGTTTTCCAACAAGCTGATGGAACCGCCGGTG
GCGTCCAATTATATTTGGGACATGAACGCCAACTACCATCGGCTCAGCTTGCTCGAGAGCATCCCGGAGATCGGGGTTGT
GATTGTCGGCGGCATGTTTGGGCGCGTGGCAGTGCTGCGGCTGATTCGAGGCAGCCTGACGTCCAGAGGTTCGGGCAACG
GCAGCTCGCCGCGGCTGAAGCGCTGCTTCCGCACGGAGTGGGTTCTGCCGCGACACGTGGAAGAGAAGAAGAAGCTGCGG
CCGCCGTGCTGTCTGCTGGGCATCGCCGTGTCGCCGGTGCCCGAAGCCGGCGCCAGCATGTGGGACCTCGCCAGCAGCAC
CAAGAAGCGACAGCAAGAAGCCAGGTCGCCGCGGCGCTGGCGACTCATCCTGCACTACATGGACCACAGCGTCTTGCAGT
ACTACATTGAGGAGAGGAGCCTGGGACGTCGACGGCAGATTCATCTGTCCGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62