GenePrediction:GLEAN_7530 Details

Name: GLEAN_7530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1468925..1468143 (- strand)
Length: 783
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1468925..1468555 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_140:1468483..1468240 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_140:1468184..1468143 (- strand)
Length: 42
>GLEAN_7530 class=GenePrediction position=GCSC_140:1468925..1468143 (- strand)
ATGGCAAACTCGATCGTATCCGATCCCGGCCTCGTGTCCCTGCTAGAGGCGGCTATCGAGGCACGGGAGCAAGCCTTGGC
GCTTGTCAACTTGGCTGCAGAGAACGCCGCATCGACAGAACTGCCCCCGCCTGGGGATACGGCTACGCGAAACGACCGCC
TTATCGAGATCTCCCAGCAGCAGAAGCGGCTGACAGCCAACATCGCACAGCTGCGGAGCCTACACCGGGCGGCTTGCTTC
ACTGCACGCGACACCAAAGCCCAGACAGCGGAGGCACGGCAAGAGGTGGACAGACTGCATCTCCAGCTTCAGAACCTTTA
TTACGAGCAGCGGCACCTCCAGGGCGAGATTTCCGCCTGCGAAAACTATGAGTGCGTTAGCACACCTCTCCCCCCCCCCC
CACTGTAGGTAGGCGGCGGCTCTAATGAATTCAACCGAACAGTCACTCGTACAAGCATCTGCCCCTCATCTCCGTGGAGG
AGTTTCTGGAAGCGCAGCCGGAGCATGCGGACGATGACGAGGTCGCTCTGATGACAGCACGGATTGCGCATGAGAAGCAG
GAGCGCGAGGCTCTCGAGCAGCAGCGGAACGAGCTTCTGAAGAGGAAGCTTAAGCTGATTGCCGAGAACAAAAAGCGGAA
AGAGGATTTGGCCAATCTGGATAAGGATCTGGAGAAGTTCATCGATGTCAGTCCGCACCGCCTTTGTGTTTGCTTGGCCC
ATTTACTAACTGTATCTCAAGGCTGCCAAGCCCATTCAGAACCTCTTCGACAAGAACGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62