GenePrediction:GLEAN_7531 Details

Name: GLEAN_7531
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1465880..1461252 (- strand)
Length: 4629
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1465880..1465320 (- strand)
Length: 561
Type: CDS
Source: GLEAN
Position: GCSC_140:1465261..1465036 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_140:1464971..1464838 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:1464735..1464033 (- strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_140:1462903..1461252 (- strand)
Length: 1652
>GLEAN_7531 class=GenePrediction position=GCSC_140:1465880..1461252 (- strand)
ATGCCCTTCTTCATGTGGTGCGCCCAGCGGTTGGGAGGCTTAGCAATGGTGTCTCTCGCCCTGCTGAGCTTCTTAATATT
GTCCATGGAGTTCGTATCGAGATACGGCTACAGTTACAATTTAGAAGACAATCCGGATGGTTCACGATACTCGCCCAACG
GTACCGGTATCCTGACCGTTGTCTTCTCGTGGTATTGCCTGTTTATCCATGTTCTGGTGACAGCTTTTCCTTTGCGTGCC
TGCTGGGCTATCTGGGATCTCACCAGTTCTTTACGTACGACCGCGCAGGGCAAGACATGTGTGGACTATGAGGTAGCTCG
ACTCCGTCACAACTCACCTGCACCACTATCCAGCTTGAAGACTCAACGGCTGTCTCATATTTCTCAGAGCGCGAGCAACG
GAGCCGGCGATCTGAAGTCCAACTTGTACGAAAACAGTGAAACGGGTTTAGACCATATCATTCACGCCATCATCATTCCA
AATTACAAAGAAGAAATGGACACTCTTCGGGAGACGCTCGATGTGCTTGCATCTCACCCTCGAGCACGCAGTGGATACGA
TGTGAGTGAAGCCGCTTTGAGAAGTGCCCTGCCATTGGTTGACATGATTCCATCTATAGATATATTTGGCCATGGAGCAG
CGAGAACCCGATGCGGACGTGAAAGCCCTGTCACTCATCAAAGAGTTCGCTGAAAAGTTTCGTTTTATCGACTTCACCAT
TCACCCTACCGGCATTCCCGGTGACTGTCCTGGAAAGGGCAGTAATGTGAATTGGGCTGCTCGCAAATTGAGCGAAATGT
ACCCCATCGCCTGTCGCAAGGATGTTGTTGTCACCGGAATCGATGGTGAGCTCTCATCCACCCCATTGACCTTGGCTGAT
AGCAGTGCTAACCATGGTTCCCGGTGCAGCCGACAGCCACCTTTTGTCCAACTACTTTGCTTTGGTTGCCATGATGCACA
AGGCCTATCCAGAAACTGCCACCACCACATTATATGCGGCTCCAATCATCTTCGACCGCAATGCCGACCGTGTTCCCGCT
ATAGTTCGTGTTGCCGATATTCTTTAGTGTGCTGCCGGTCTCTCCGGCCTGTATCGGGGATCTACCATTGCCCCGCCTAC
GTCTGTGTACTCGTTACCTCTCCAGCTTGTCGATTGGGTCGGCGGCTGGGATTGCAATTCCGAGGCCATCGGCGAAGACC
TGCACATGTACACCAAGTGTTTTTTTGCCCTCAACGGCAACCTGACCGTGCGAACCGTTCTCAGTCCTATCAGCCAAAGC
AACGTCACGGCCGGCGGGTTTGGCAAGGGTGTGATTGGCATTCGGATGGACATGGGCGCGCGGTACAAGCAAGCCTTGCG
GCACATGTGGGGAGCACTAGATACAGGCTTTGCACTGTACAAGGTGATTGAGGTATGGCAGAACAGGGAACGCTCCTCTT
GTGCGTTCCGACCGCTGCATGAACCTGCCTCTGAAGTTCGACTGGCAGCCCGGCAAAGCAAAGGGAGCCCCAAGGATGCC
GCCAGGGCCGGTAGCTTTACCGATGTCACCCACGGCGTTCTTAAGGGACCCGATTACCAGAGAATATTCTATTTGCTCCA
CCGGCTCTTCGAAGCTCATTTTTTGCCTGTCCAGATGACCGGTGTGATCTTGGCCTCGGCCGCATACAAGTGGGTGACGG
ACGGCACACCAGACATCCACGGCGTCAACTGGATTTTCAGTGTATGCAAAGGCCTCCGGACCTTTGGCTTCATTGAAGTG
GCCTTCTACCTTTTCTTGTACGAGAGCTACCATAAGATCGCACTCTCCATCCGCGAAAAGGAAATGAACAATGTCGGCCT
TGCTGAGGGTATGAATTTCTCTCATCGCAGCCTAAAGAGAAATTGCATTGATTACTTCATGGTTCCTCTGGTAGCCCCAG
TCTATGGCGCACTTCCGGGCGCACTGGCACAGTTCAGTCATTTCTGGACCGTGGATCTGGTATATACCGTGAGCCAAAAA
GCAACCCGCCAACGGGCAAAATCAGGGTCTGCGGAAGACATAACCAAGGCTACATAACCCGTTTTTCTCGTTTCATTATC
GACGCCTTTCTCTCATATCCTCGCGTACTTTTCTCTACTAAAGGGCATTTCCCATACTGTCGCCATATGTAACACACTCT
TGAAGGCATCCACGCCTCTCAAATGGATCTCTCCTGTGACACAACATCAATACTACTTTACTTTCTACCAGCCATATTTC
ACCTCAAAGCCCCGCGGTACTTATAATATGAAGCTCGAGTCATGACAAGTCGTCGGTTAGAGGAGACCCAGTTATACGAT
GCAACAACGTGAAGGCTAGGTGGGCGTGGAAGCAATCCGACTTTCGACTAACCTATAAAACCTGATAGCAAAGTAGACAT
ACAGTTGGAAAGATGTTCTTGGGGTCCTTTTACAACAAATGCCATTAAAATAATGAGTACGAAGAAAGGCATTGTCTAGA
ATGAATGGTTACATAATCTTCAGCCTTACGGAACAAAAAGATAAGCAGCAATTGATGAATCGATGATTGACATGATGGCC
AAGCGTTGGAACCATGGTGGATCGCAATCATGGATTGAAAAAAAAAAAAACGTACAGCAGCGGGTATTCGCTGGTCGTCA
CCGACCCAACTACTAATCCGCCGATTACTGGTTTAACTAGGGGAGAGCGGACGGGATCCCGTGCTTTCCAGTATCTATGG
CCGTACGTGACAGAGTGGATGGCAAAGCAGCTTATAGCGCAGCGTGCGGCAGGGGTGCGGCCATTGCTCTTTCTTTGTTT
GTGCTGGAAACTGCAGTTGCTTTCCGAAGAGAGAAGGCACGAAGGAGGGGATATGCAGTTCCAAATACAAATCGACAGAT
GATGTTTTATTTCTCATTTCAATTGCCTCACATCCTGTGAACAGTCTCGGCTTTATTCCCCTCTCCCTCTCGTCATCTGA
TCGCCCTGCCACTCCAGCAGACGGATCGACAGACACGGTCTTTTTACCGCGAAGCAGCAAAGAAGGGACCAGCACCCGCG
CAGGCCTGGCGATGGATGACCCCTCAGCGATCACGGTGCTCACGCTCAACTGCTGGGGCCTCAAGTTCGTTTCGGCGTTC
CGCGAGGAGCGGCTGGCCGAGATCGGACGGCGGCTAGCGGTGCTGGCAGCAGCGCCGGACGCACCGGACCCGACAGGCTC
GACAGATCCTAGCTCGCCCGTTCGGCCGCCCGTCTCGATTGTGGCGCTGCAAGAGTGCTGGTGCCAGTCAGACTTTGAGA
CGGTGCAGGCGCTCACGCGCGACGTGCTGCCGCATGGCAAGTTCTTCCGCAGCGGGGTCTGGGGCGCGGGCCTGGCGGTA
CTCTCGTGCTGGCCTATCACGCAGGCCAGCATGCACGCATATGCGCTCAACGGACGGCCAACGGCCTTTTGGCGCGGCGA
CTGGTTCGTCGGCAAGGGCATCGCCAGCGCCACAGTGCGCGTCAGTCCGCGGCTGGTCGTCGACGTGCTCGTCACCCACA
CCCACGCACCCTACGAGGCCGGCCGGCCCGACGACTCGTACCTGGCCCATCAGCTGGCCCAGACCTGGGAGATGGGCAGG
CGTGCGGCTGCTGCGGCCGAACGCGGCGGCTTGGGCTTGTCTGCTCGCCTCGTCGTCGCTGTGGGTGACTTCAACATGCT
CCCGCAGTCGCTGCCGTACCAGATGCTCCAGCTCGGCGCCCGTGCAGAAGCCAGCACCAGTCCCAGCCTCCAGCTGCTCG
ACTCTTGGCGCGTGCTGCACCCGCAGTCGTCCTTCGGCCCTGCTGCCTGTCTGGCCAAACAGGCCCGCCAAAAGTTGCAG
ACCACCGCCGCCACGGCAGCACAGATCACTGTCCCTACGGCCGCCTTCAATCTGACCGAAAACGGCGCCACGTCCGACAA
CGTGCTCAACACCTGGCGATGGCCCAAGGACAAGCAGAAACGCCTCCTCCAGAGCTTCCGCAATATGTCACCACCAGGAC
CCTCTTCGGCTGTCCACAATGACGAGTTTGACATCGCCCCAGACACGCCCGACCCGTGTGGAAAGCGTCTCGATTACATC
TTCTACATGTCGTCTCCACCAATACCACCAAATGCTGACTCCTCATCCATTTACCACAGCTGGACTGTGAAGACGGCACG
TGTCGCCATGGTTGAGCCTCATCCGACGTTGGGCTGTTCTGTGAGCGATCACTTTGCCGTCGAGGCCACACTGGCCCTCG
AGTTCAACAGCCAGGATAGCGATGCAAGTGGCAGGACCGACGAAACTGCCGACGTCGACGTCTACAATAGTGTTTTGGCT
GAGATTGACCGTTACATCGCCCGCGAGCATCGCCAGCAGTTTTGGCGCTCTGTCCACTTCTTTTCCGCCGTCTTTGTCGC
CGTAGCCTGCCATGTCGCCATGTGGTTCGTCCCCCGCTTGTTCGTCGCCTTCCTGCTCATGCTGCTCAGCAGTCTCGGCC
TTGCTGCCGGCGCCATCGACGGCCTCCTAGCTCTCCTCTTCTTCGGCTCTGAAATTCGCAATCTGGAAGAGTTTCGCTGG
CAGGTTTCCAATGCTAGAGCTGCCGTTGCTGAAAGCCTGACCTCGCTTCCAAGTAGCGAAAAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62