GenePrediction:GLEAN_7533 Details

Name: GLEAN_7533
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1442443..1441373 (- strand)
Length: 1071
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1442443..1441878 (- strand)
Length: 566
Type: CDS
Source: GLEAN
Position: GCSC_140:1441814..1441373 (- strand)
Length: 442
>GLEAN_7533 class=GenePrediction position=GCSC_140:1442443..1441373 (- strand)
ATGCGGCTCTTTCTGCTGCCAATATCTACGCGCCGCACGCTGCTTTTCTGTGAGCGGGTACTGCCACCATCGTATCCGCC
GCAGGCGACAGCCGGTGACCAAGCGCAAGCGCAAGACGATGCAAGCAAGACAGACCAGGCAGCATTGACGCAGACGCAGA
CGCAGCTGCAGGTACAGCCACGGGGGAATGAATCTCTGGTGGACAAGGCACAGGATCGCGCCGCCCGGTTCTGGGCAGGC
TGGGAGAAGAAGCCGGCGGGTAGCTGGCAGCGTCGTCTCGTCGCCTACGGCAATGCTGGCTTTCGCCGCATCACGTTTGA
GGAGTGGGGGCTCAAATCGGTGCCGCCGCTGACGCGACAGCACAGGCTGGCCGTTGAGAGTGGCGACCCTTCCCTCCCGG
CACCGCCGGTCGTCGAAATTGTCTTCCCCCCGTCCATGCTTCCACCCGGCAGCGTCCCCGGCCTGCTGCACCGGCTTAGC
ACCGAGCGCGAGTCTCTCCACCGTCAGCGGCTGCTCTGGTGTCTCGTCGGCATGCCCATCACGCTGCCGATAGCCGTCCT
CCCAGTGTGAGATGCCTCCTCCCTGAAACCTATTTGATCTGACATGACTTGCTGACACTGACCGGCCAGCGTGCCCAACA
TCCCGTTCTTCTACCTCGTCTACCGGGCCTGGTCGCACTGGCGCGCCATCTCGGGTGGCAAACACATCCAGTTCCTGCTG
CAGCACAACAAATTCACCCTCTCGCCGTCGCCAGTTCTTGACGCTGTTTATGCAAAGGAGAAGGCGAAGTTAGCTGCCGC
TTCAGCTACTACGGCTACTGCCGTTGCGCCAGCACACACAAAGGAGGGGGCCAAAGAGGCGGAGGCGCTTCTGCTGTCGA
ATCCCGAAGGCGCCATGGCGGTGTCTGAGGCGGTCGAATCGCCGCAGCTGGAGCTCGAGCTTGAAAGGGCCACCTGGCAG
ATCGAAATGGCCATAGGCAAGGCCGAAAAACAGGCAACAGACGATCGTCAGTCAGCCGAGTCAGGAGCCGTTGGTGGCCA
ATCAGAAAAGGTGAAGAGCAAGTCGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62