GenePrediction:GLEAN_7534 Details

Name: GLEAN_7534
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1439570..1434204 (- strand)
Length: 5367
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1439570..1439398 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_140:1438979..1438962 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_140:1438893..1438582 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_140:1438472..1435869 (- strand)
Length: 2604
Type: CDS
Source: GLEAN
Position: GCSC_140:1435803..1435747 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:1435261..1435161 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:1434578..1434423 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_140:1434349..1434204 (- strand)
Length: 146
>GLEAN_7534 class=GenePrediction position=GCSC_140:1439570..1434204 (- strand)
ATGGAAATCGACGCCTCGAGGCACCAGCCCTCCGTGCCGGGCTTCGCTCCAGACGAAGCTACCACGTCCGCCGACCCAGG
AACGACAGCGTCCGCGATGGCACAGAACCAGAATAATGCGGCGGCTCAGGCAGCTGCACAAGCAGCCGCGCAGGCACATC
TCAGCTTTAGAAGGTAGGAACTGGCTGGCGCATGGCGCTTGGCGTAACGGTCCCGCGAATTTTCGTCGGCCTGGGGTCGC
ATGCGGACTGCTGGCGCGATCGAGCTTCCGCCTTGATAAACATAGGCAAGACGCAGCTGGCTAACATTGTCCTTCTCATC
TGAAAAGGCAACGAGCATCGAGAGCTTGCGAGGTACGCTTTTTTTCTTTTTCTTTTGGTTCTCCAACCTACGTCCTTTTT
TCCAATGCGAAACCGAGTGTGCGGTCGTTCTATATGTATCGGCTCTTGAGAGCTTGCCCAGAATGGATACCCACAAAAGT
GCCGAGGCATCTCCATCAACGAGCCTCACAATTTCCCGGTTGCCATTCGCCCTCAACTCGTTTTCCTAGTGCCCTGCTCC
CTAATCGACCTGTTGGCTAACTTTCTTACAGACATGTCATGCTAGAAAGGTAAATTCTTGATTTGTTTCAGCCAGCACCC
CCTCTCTCCAAGCCCTCCATGCAGGTCGCACATCCAGCAAGACCGAGGCACATTGGCCCGAAACCCCTCTTCTCCCCGTC
CCGTATTGCATCTTCCTTCGCTCCACTACCTCCCGTCTCCTGATTCAGGCCACTACCCAGAAGGGAGATCTTCCCGGCAT
AGGGCGCTTTCTCATCATCCTTTTTCCCCAGGTCCGCTGCGATGCCGCTAGTCTGGGCGTGCCTTGCACAAACTGTGTCG
CATTCAACATTGAGTGCCGTATCCCCACTCCCAAACGCAAGAAGGTCGTCTCACAGTCAACGGCCTCGGCGACGGGAACT
GCAGGCTCGACATCAAAAGACTCCGACAGGTATGAAGCGCTGTTGTTTCCTGGCTCTTGATCCCTATTTTATTTTCACAT
GATTTCTGCCTTTTTCAAAGACCTACAAACAGATTTTTGCGTGCTCACATCTGCATAGTGATCGTGGGGATGGTTCCGAC
GACAAATCACCACGATCGAGCAGTGTTGCTGCGTCCACTACGTCGGGACTAGCGTCCGTTTCTGCCACCCCGTCTGTTTC
TCGGCCGTCTGTTCACCACACCTATGAAGGCACGCCGTCTTCAACGGTGACGGAGCTGCAGGCCAAGAAGCAAGAAGTCG
ACACAGGCACATACGTTAACATCCTCATGAAGCCCCGCTTCACTCGTGCCCCCATCACGGAGCCGGGCCGTGTCGCCTAC
CTTGGCGAGTCGTCTAACCTCACCCTCTTGGTCCACGACCAGGCCGGATCTGCCGATGTTGTCCACTACCCTCTTCCCGA
GAATGTGCGTGGATCGCGGGCCCGTCTCACTGAGCTCGATAATGTCGAGATTGAGATCCTCCAGCAGCGTGGAGCTTTTC
TATTGCCACCACGAGAACTCTGCGATGAGCTGATCGAGGCTTATTTTGTTTGGATTCACCCGATCATGCCTGTCATCAAC
CGTAATCGATTTATGCGCCAATACCGCGATCCCAACAACCCGCCTTCGCTGTTGCTTCTTCAGGCTATCCTTCTGGCCGG
CTCGCGCGTTTGCAATAACCCAAAGCTTATGGATGCGAATGGCTCCACAACACCCGCTGCCCTGACGTTTTACAAGCGTG
CCAAAGCCTTATATGACGCCAATTACGAAGATGACCGGGTTACGATTGTGCAGTCGCTGCTGCTCATGGGATGGTACTGG
GAGGGCCCGGAAGACGTCACCAAGAATGTCTTTTACTGGAGCCGTGTCGCCACCATAGTTGCACAGGGCTCGGGCATGCA
CCGCAGTGTGGAGGGCTCTCAGCTTAGCACGACGGACAAGCGTCTGTGGAAGCGAATCTGGTGGACGCTGTTCACCCGTG
ATCGGTCTGTGGCCGTCGCTCTCGGCCGTCCTATCCATATAAATCTGGAAGACTCGGATGTCGAGATGCTGACAGAAGAC
GACTTCAACGAAGACGAGCCAGACCTGCCGAGCGAGTATAAGCCAGATCCGCTCCATGTGCAGTTCTTTCTGCAGTATGT
TAAGCTCTGCGAGATCATGGGCCTGGTGCTGTCCCAGCAGTATTCCGTCGCATCAAAGGGTCGACAGAAGAGCCCCATCG
ACCTGACCCACAGCGACATGGCTCTGGCCGACTGGCTCCAAAACTGTCCGCGGATCGTCTGTTGGAATATCCAGGGCCGC
AGCTTCTGGTCTGCGCTGCTCTTCTCCAACTACTACACCACCCTATGCCTGCTGCACCGCGCATACATGCCGCCTGGCTC
GGGCTCGCAGCGACTCGCAGAAGACCACACCGCCTACCCGTCAAGAAATATTGCCTTTCACGCGGCCGGCGCTATAACGT
CCATTATCGAGTATCTGTCAGCTTCGGACGAACTGCGGTATTGCCCTGCCTTTATAGTCTACAGTCTCTTCTCTGCCTTG
ATCATGCACGTTTACCAGATGCGGTCGCCGGTGCCGTCGATCCAGCAGGTCACGCAGGAGAATCTTCGGACCTGTATGGG
TGCGCTCAAGGATGTCTCCAAGGTCTGGCTTGTGGGCAAGATGGTCTACGCCCTGTTCGAGTCCATCTTGGGGAACAAGA
ATCTGGAGGAACGGCTGAGAAAGGCCGGTGGCGTGCGTCACCGCAAGACGCAGAGCAATCATTCGAAACCAGAGAATCAC
GGCAATGCACAGAGACCACAGAGCCTGTACCACCAGCAACAGCAACAACAACAACAACTCCAGGACATCTCGAAGCGCAA
GTACGACGAGATGGCTATTGATTTCAGCGTCAACACGCCGCAGCCGCAGGAGTCTTACGAACGTTCTCGGCCGCAGACGC
CGAACCATTCGTCAGCGTTGAAGGGGGAGCAGACGAATACTGCGATGGGCCCGCCATCTATGGCACCAGGAGGAGCAAGG
CCCGCGATGGACACGTTTGCTGGAGGCGCTGGTGGCATTGGGGGCAACGGCTCGACGTCGCGCCCACAAACACGTCCACA
CACGCCGTTTCCGTCGTCCTTCTCTCTGCCGACAACACCGCCAGACTTGTATCTGGTCACTCGCAACTCGCCCAATCTGT
CGCAGGCGATTTGGGAAAACTTTCAGCCGGACCAGCTCTTTCCGGACAACACTGGCTTCTCTACCATGTTTCCGCCGACG
ATGTCGCCGACGCCATCGAATCAAAACATGGACCCCAATATTATTGCCCCGATGCAGCAACAACAACAGCATGCGCAACA
TCACCAGCAGCAGCAAGCCCACCAGCAACAACAACCACAACAGAGCCCGTTTACGCAGCACATTTCACCGCCAGCGTCAA
CTAAACGGGGGGCCGGCAGTGCTTTGGGCGCAGGAACCAGCCCCCTGTCGCCGCCGGGGATTGCGGCTCAGGGACTAGGT
GGATTCCAAGCACAGCAAGCGCCGCATCAACAGCAACATCATCACCAGGCAAATAGCAGCAACACCATGTGGCAATCGCC
CTTTGATGGAGCGCTTCCGGATGGGCAGAGTCCGAGCGACAGCTGGAGCACAGGATCGGTGCAGGGACAGCCAGTGCCGT
CCACGCTGAATGTGGAAGACTGGTATGTTCCCGGAAAGATTTGGATACACAGCAGGAAGACTGGGACTAACCAAATGCCC
GGCACAGGTTTCAATTTTTCGGCATAAACGGCGGCGATGCTAACGGGATCAACCTGGACTTGTCGTCAATCTAATACAGG
GGAAGTAAAAGAACGGAGATACGCCTCCTGGGACATATTAATAGTATTTGTGCCATGATGAAATGACAGGAGCAAATTGA
GTTATGGCTTGGGTCGGACTGTATGATAGGATACGAAACCAGTGCACCAAAGTGTTGGAGAGAAGAGGTGGTCGTCGGAC
TAGCAACACATCATGCGAGTATTGATTACTACCCTGATCTTGTGTATATGACGGCGGAACATGCCGGGAACAGGACACAT
GGCGGGCAAACGAGGGTTTGTATTGGCAGCGGTCGTTCTCGCCAAGAAATCATGCATAGCAGAGCTCTCCTTTATTAAAA
GGCAAAGGCTATCTGCACTAAAATCGAGGTACAGCGAGGATGTAGATGAACGAAGCTCGGGCGCAGCACACCGTTAGTGG
AAATGGGGGGTCAGGAAATTAGCCTCGGGTGTGCTGACGGGTATACAAGAAGATGACGAGTCTGTATAGGATGAACGTTT
CTGCCTGGAGGACCAGAGCTTTGGTGCTTGCGGCTTTTGCCATTCCACTGCACAGCCTTGGGACTAGGAGTAGTGGCTCT
GGGCACGGAGGTCTGAAAGCAGAAGACCCGCCGGAGTGGTAGATGCTGCGGTCTAGACCTTTTGTTGCAAGACGAAAAGC
AAACGGCTCTTCTTCCTCTTCTCGCACTCTCTGTCTCCCCGCACTGTGGTTGTGCGGTTGGGCGAGCTAGCAATAAATAC
ACATCCAACAGGGAGATCTTCGTTGGAGAGCATAGCCACCATTGGCACGAGCGAGGACTTTCTCCAAACGTTCGCCTGGT
GATGCTTCAGGGTGCGAGCTGGTTCTGGGCTAGGGGGAACCTACTGCGAAGCCACACCTCAGCTGCAACTGGCGAATAGG
ACGACAGGGCCGACCTCTCGACTATCTCGGTCTAGGAGCAGCTGATAACCTCTTGTAATGTATGCATGGGCAGGTGACGA
GGGCGGTCCAACGGCAGTCCTGGCAACATATAAAGGCTCACCTCATAGCTTGTGTTCTTCTGTTCCCCCCCTCTCTTTCT
CTGTCTTCGTCCGACGAAAACCAGCTGACTATATCACACACACACACACACACATTATGACTGGCCAGTTCTCTGCCCTT
TCCACATGTCGTTCTCATCTGACCTGTGACAGAACCCAAGACGATCTCGGTTGGTCCTGACGGCGTGGCCCCCGACAGCG
TGGCAGGCTCGCCGCCTGTCTTTGGCGAGTCTCCTCCCACGACCGGCTTGACCACCGGCGGCCTTCTCGAGGTCAATCCA
CAAGACCGCCGTGGCAGCGCCGAATGGGGTAAGTCTTCTTGCTGTCTTGTTGCTCGGCGTTGCTCGGCGTCCCCTACTCA
CGTCACACTGACCACCTGTAGACGCCTCCAAGGTGCCACCCAGTCGATTCCAGAAGCGCAAGGGGTCGATCTACTCGACG
CCCAACTCGCGTGATGGCCAGGTCGACAGCAACTACGCGGCCAAGTTTCATGCCAAGCACGCAGAAAAGGGCTACAACAA
GAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62