GenePrediction:GLEAN_7535 Details

Name: GLEAN_7535
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1430673..1429430 (- strand)
Length: 1244
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1430673..1430659 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1430590..1430478 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:1430417..1430407 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:1430331..1430006 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_140:1429951..1429903 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_140:1429835..1429826 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_140:1429763..1429723 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:1429665..1429430 (- strand)
Length: 236
>GLEAN_7535 class=GenePrediction position=GCSC_140:1430673..1429430 (- strand)
ATGTCTGGCGCCGCCGTACGTCCCGATGGATGGAAGCGAACGACTGGAAACAGAAACGCTGACCAATTTGATGACGTGTC
TAGGAACGGGAGGCGGTATTTCCTACCCGGCAGTCGCTCGGTATCATGAAGGCCAAGCTCAAGGGTGCAGAAACAGGACA
CAGCTTGCTGAAGCGGAAGAGCGAGGCTCTGACAAAGTGAGTTCGCCTCTTGTCCTTGTCCTGTGGAATCAGCGCAGCTG
TAGCTAACCGGGCCAGGCGATTTCGAGGTATCCTGCGATCCATTGGCCTCGTCTAAGCTCATATGGCCGCATCGCGACAA
CTAACCGTGTCCTCCTTCCCAGACATCACCCGCCGCATCGACGAAGCCAAGCGAAAGATGGGCCGTGTCATGCAGATCGC
TGCCTTCTCCCTCGCCGAGGTGACCTATGCTGTCGGCGGCGACATCGGCTACCAGGTGCAGGAGTCGGCGCGGTCGGCGC
GCTTCCGCATCCGTGCCAAGCAGGAAAACGTGTCGGGTGTGTTGCTTCCGGCCTTTGAAAGCTACCTGACCGAGGGCAAC
AACGATTTTGCCATGACTGGCCTGGGCAAGGGCGGTCAGCAGGTCCAGCGCTGCCGCGAGACGTATGCGCGCGCTGTCGA
GGCGCTGGTCGAGCTGGCTAGCCTGCAGGTGAGCTGTTTTTGGCCTGAGTGAGTCTTGGTCGTCCAATCTGACGCTTTAC
AGACTGCTTTTGTCATCCTGGACGAGGTCATCAAGGTGGTCAACCGAAGAGGTATGTTGCTCGCATATTCAGCCAATTGC
CTGCAGACTTGCTGACATGCTTTCTCTTCGTCTCCCAGTTAATGCCATGTTCGTATACACTTTCGTTATTGGCCCTATCT
ACGTGTGGTTTGCCCTTCTAACCCGCACAGCGAACACGTCATCATTCCGCGGACGGAGAACACCATCAAGTGTAAGTGGA
CACAGACATGTCGCCAAGGTAGAGACAGACTGCTGACGAGAGGACCAGACATCAACTCGGAGCTCGACGAACTTGACCGC
GAAGAATTCTACCGGCTCAAGAAGGTGGCCGGCAAGAAGCAGCGCGACACGGCCGAAGAAGAAGAGGAGCTCAAGGCGCG
CAAGCTGGAGCAGGCCAAGAAGAACAAGGACAAGGACAGTGCCAAGGAAGAGAAGGAGTCTGCGAACCAGAGTGTGCCGG
CCGATCTGCTGACAGCAGAGGGCGAAGAGGACGTCATCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62