GenePrediction:GLEAN_7537 Details

Name: GLEAN_7537
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1415503..1413653 (- strand)
Length: 1851
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1415503..1415416 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:1415366..1415306 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_140:1415205..1414536 (- strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_140:1414447..1413653 (- strand)
Length: 795
>GLEAN_7537 class=GenePrediction position=GCSC_140:1415503..1413653 (- strand)
ATGGCGCCAGCGTCCGACCTGTTTGCAGGCTTGCGGCAGGCCACCGACGGCGAGCATGCAGCAGTCGCAGCAGAAACACT
TCTTCCGTGTATGTCATCCACTCCCGGCTGTGCTGTAGTTCCTGCTGACCTCTGCAGATGTCCCGGCAGCTTTCACATGG
ACGGAGCTTGCCCGAGGGCTTGCTGAGAGCGACGTGAGGTTCGCCCTGCTCTTCACTCTCTGCATGTGCTGACATTCCTC
AGACGAATCTGCTACGGATTCATGCACTCCATGTCTGTCTCACGGCCGAGCCGAGCAGACGGAAGGATGAAGCAACGACG
GTAGAAGAGGGAGCAAAAGACACAGAACCAGATGAACCACAAGAGCCAGAAGAAACAACATGGCTCGACGCGGCCTCACG
CAGAACAATCCGCACCTTTGTCGCCCGCACCATGGCACCGATTCTGGGGAACGACGACGACGACGACGATGACGAGGCCA
CTCGTCACGGCGACCGCACGAGTAACCAGCACGCGGCCGCCATGCGATGCAGTCAGGCCGTTGCCGACGATGCGGTCGCT
GTGCTGCGTTGGGCCCTGGCAGACGACGACACCCTCTCTCCGTCCGACAACGACGACGTGCAGGTGCTCGCTAGCATCAT
CGCCGCGGCCGAGGCCGGTCAGCCGTGGACGACCGGCACGGCTGCGGCTGCGGCTGGCGACCTGCTGCAGCGGCTACATC
CACAACTCCCGTCTGCCGACTGGATCGTCGACGGGCTCCTCAATGGCTACGTGCGCCCGTTGTTTGCTCGCGGCCCACGA
CCACAAGGCCTCACGTCGGCCGGCCGTAAGGACCAGTACGGCGACCGTGGCGGCGGCGGCGGGCTTGCCTCGCGAGCGAC
GGACTCGGAGACGCGGGCGGCCAAGCCGTGGAAGTACGGCGATCTGCGCGCCGTACCAGTGTTTTCGTGGGCGCTGCAGG
AAAGCGATGTGAGTTTGCTTAGTCATCATGATCACGGTTCTGAATAGAGTCATTTGATATGTACCCCCCATCCACCCCCC
CTCGCTAACTCCATAGTCTGCCCTCGTTGGCCGCCACTGGTCCCTCTTCACGCCCGTGCTACTAGCCCTCGTCGACGATG
CCGACACGGACGTGCGAGCACGTGGGCTGGTGCTGCTGCGAGTCTTTGTCGACCGGCTGCCAGACGGCGGGCGGCTGCTG
CGCCAGACCGGCCTAGACAGCGTGCTGGCCGAGGCGGTGCTTCCGACGCTGCTGTTCTTGCCGCGGCTGACGCCGGAGGA
GGAGTCGCTGCAGCTGCTGGACCCGGCCTATGACGCGCTGCTGGCGATTGCCGCCAAGGGAAGCACCTCGACATCCACCC
TCTTTGATCGGATCCTCCGCGACGGCATCCTGGCCGGCTACTTCCACGCCAGCGAGCACGTCCGCGTGGTCGAGGTGCTG
GCCCGCCAGGCCGGCCGGCTGGTCGAGGCCATGGGCATCGCCGCAACCAAGCACCTCAAAGACGTCGTGCCGCTGTGCGC
GGCCATCCTGACGGACCCGTTTGCCGTGCGTCACCCGCCCGTGCTGGTCGCCGCCACGGCCACGCTGCAGGCCACGCTCG
CCAGCTGCTGGCCGCGCCTGGCCGACTCGCCCTGGCCGCTCGAGGTCGTGCGCATGCTGATGCTCTGTTGGCTCAACGTG
GCCGAAGCGGACGACAACGATGACCGGTACACGCAGCTGCGGGCTGACCTCGTCCGGGCAGCCGACACACAGCTGACCAT
CTTGCGTGCGGCCCAGGCCGATGTCGGCCGTGTTGTCGGACCTCTCACGGTCAAAGAGCCACAATTAGCCGAGCTGTTTC
GAGTCGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62