GenePrediction:GLEAN_7538 Details

Name: GLEAN_7538
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1409086..1407034 (- strand)
Length: 2053
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1409086..1408938 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:1408878..1408768 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:1408673..1408297 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_140:1408239..1408007 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_140:1407906..1407034 (- strand)
Length: 873
>GLEAN_7538 class=GenePrediction position=GCSC_140:1409086..1407034 (- strand)
ATGACTTTCTCGGCCAAGCCCAACATGCGCAAGTACCTCGACGCCGAGTACTGGCGGCTGGATACGGCCCAGGCCTCGTA
TGCCACGCGGCACGGCTGGTCCAACGAGGACGTCGACATTGTCCCGCCCGAGAAACGGACCTGGAGAGCGTACGTGACAG
CGCATCGATCGCGGGAACGCAGACAGCGTGCTGACCAGATGTCTGCAGCTTCGACTATGCCTGGCTTTGGCTGGCGGACG
GTGCCAACGTCGGCACCATGCAGCAGGCCGGCTCGGTCGTCGCCATGGGTCTAAGTTGGCGTGAGGCCTCTGTGGCCATG
TGAGTGTTCTAATCCCTGAGCTTGAGCTTGGCTGAGCTTGGCTTCGATGGTCGGCCAGACAGCGGCGACATCTCGGCTGA
CGGCCATCCGTAGCGCCATCGGCAATCTTATGGCCGGCGCCGTCGTCGGGCTCAACGGAATCCTGGGGTCGCGCTGCCAT
GTGCCCATGTCCATCGGCTCCCGAGCTTCCCTGGGCTTCTACCTGTCCTACTTTGCCGTCTTTTCGCGCTTCGTCCTCGG
CCTGATCTACTTTGGGTGTGTGCTCTCTTCTCCGCTGCTAGCGGCTGATCGTCTGATCGCCAGACGGACTAACCCGGCTT
TCCCCAGCATCAATACGTATATTGGCGCTTCGTGCATGCTCATCATGCTTGAGGCCATTTGGCCTAGCCTCAAGACGTAC
CATAACGCGCTGCCGGCTTCCCAAGGTGTTGCTAGCAATAAGATGATTGCGTACTTTGTTTTCTGGATCCGTCAGTAGAA
GCTCCTCGTCACCGTGCCTGTTCTTCTGCTGACCAGACGTCCGACAGTGCAATTTCCTCTCGTGATGATCCATCCCCGAA
AGCTGCGCTATCTCTTCATGGTCAAGTCCACCCTCGCCGTCATTGCCGCCTTTGCCCTGTTGGGTTGGGCAGTGCACAGA
GGAGGCGCCGGGCCTGTCTTTAGCCAGAAGGCAAAGGTCCACGGCGCCAAGAAGAGCTGGGCCTATCTTGCAGGCATTAA
TGTTGTTGTCAGCAGCCGAACAACGCTTGCCTTGAATATTGTGAGTGCGAAGATAGAAGAGAGAAGAGGGAGAAAGAGAA
AGAGAAAGAAAGAAGAAGATAAAGCGAATCAAAACAAAACCAACACAACTAACCATCCAGTCTGACCTCACTCGCTACGG
CCGCAAGCCGTCAGTGACCTACTGGCAATCGCTCTACATCCCGATCACGTACTGGGTCTTTTCCTTTATCGGTATCGTCG
TCTCGTCAGCCAGCCAGGCCATCTACGGCAAGCTCTCGTGGGACCCCACGACGGTCATCGCCCGCTGGGACAGCCGGGCG
GCCGCCTTCTTCTGTGCCTTTGCCTTTGGCCTGGCCACGCTCGGCACCAACATCTCGACCAATTCGGTCGCGGCCAGCAA
CGATCTCGCCTTCATGGTGCCGCGCTGGATCAACCTGCGCCGCGGCTCCTTTGTCGTCTCGCTCATCGGCGGCTGGGCCA
CGGCCCCGTGGAAGATCCAGAAGAGCGCCACCAGCCTGACCACATTCCTGAGCGGCTACGCCATCGTGCTGGCGCCCATC
CTGGCTATCATGATCTGCGACTACTACATCATCCGCCGCGGCCGCATTCACGTGCCCATGCTGTACCAGAACGAGGGCAT
CTATCGCTACTGCAACGGCTTCAACTGGCGCGCCCTGGCCGCCCTCCTCGTGGCTGTGCCGGTCAACCTGCCCGGTCTGA
TCCACGCGATCAACAGCAAGGTCAATGTCGGGAACTACCTTTACTTTTGTGAGTCACGTGACCATACCAGCGACCTTTGC
TTGCCTACTGACAGCGGCAACAAAGACAAGGCATCGTGGCTGACAGCGATGTCCATGTCTGGATGCATCTACACCATCCT
GAGTCTCGCGTTTCCACCAAAAGACACCTTTGTCGAGGTTTCCGCATTCGAAGAGGGGGACACTTGGAACAAAGCAGGCA
AAGATGACCGTGAGGCGGGCAACATTGAGATACCACGCTGTCGTGATTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62