GenePrediction:GLEAN_7543 Details

Name: GLEAN_7543
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1388517..1386790 (- strand)
Length: 1728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1388517..1388464 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:1388271..1388073 (- strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_140:1387982..1387020 (- strand)
Length: 963
Type: CDS
Source: GLEAN
Position: GCSC_140:1386959..1386790 (- strand)
Length: 170
>GLEAN_7543 class=GenePrediction position=GCSC_140:1388517..1386790 (- strand)
ATGGAGAAAGCGGCCGAGTATCTCGCTGATGAGGTCCTTGCTGAGAAGCATGTGGTGCGTTTCTCCGCTTCACCGTCTTG
ACTGTCACTTCTAACGCGTCCAGGTTACCTATCGGTACTTGAGCAGAGCCCTGAAACTGCATGTCAATGTGGCAAAGAGG
TATATATGCGTTTTGGAAACGGCGGTATAACACGCGCCCTAGCTTACTGGTCAATTAGAGCACTGTTTGAATTCCACAAA
TCGCAGAATGTCAAGAAGCCCGGCTCGGTTCACGCAACCTATCTTCTATACGGCACGAAGCCGGTCGAAAAGCCAAGCCA
CCACGAACATGCCGATTTCGACGAGGGCAATGTTTATATGGACGGCCAGTACTCGGAGGGCGAAATGTTCTCGGATCCGT
TCCCCACCGTTTCTATGACCCTGGTTGCCGAAGAAGCCCTAGAAGGTGCGTGATGCTGCTTTCTTTTGCCACGGCGTAGC
AGCTAATCCAAGATGCATATGCGCGCAGGTGCACTCTCAAAACACGATTCCATAGAGTCTATTCACGTCTATAGCCTTTC
TTCTCAGCCGATGTCGGTAGGTATCTTCCGTATTTCCTGGTGGAGCATGAGCGCTTTGCTCACAATGGCACAGGATCTCC
AACTTCTTGCCGACTCTACGCGAAAGCTACGTGAACTCACCGGCGCAGATGTCTCGGACAGTTCCAAGGTGTACGGCACC
ATTCACAACCCGCACGTTCGACGGCGTCAACGCAAGGGGCAGGCACCAACATTGGTCTCTCGCCCTTCCACCAAGCCTGC
TTCGAAGCCAACCCTGGCCCCAACCGATTCTCCCGGGCCGCAATCGATATGGAACAAAGTGGCAAAATCTGCTACAAAGG
ACACAAAGGAAGAGGGAAAGACCGATAAGCCATCCGTGGACGCGCCAGGGCCAAACTCAATATGGAACCGGGTAGCCAAG
ACAAAGGATGCCGAGAAAACGGCTGGGGAAACTGCACCAGCACCAGCTGCTTCAAGCGCAGAGACAACGAAATCATCTAC
GCCAGCAATAGCAAAGAAGACCTCGTCAGGCGGTATTATGCAGGCGTTCGCTAAAGGGGCGGCCGCTGCTAAGCCCAAGA
AGAAGGAGCCTGTTGTCGTGGCCAAGGAAGATACGGCCATGGCCTTGTCAGATGATGGAGGAGACGACGACGACGACGAG
CTTCTTCCCAAACCTCAGACAGGACATGGCGTGAAGTCTCGCAAGGAGCGAGAAGAAGAGCTACTCAAGATGATGGAAGA
AGACGATGATGAGGAGAAGTCTGAGGAGGACGAGAAAGAGGGAGAAAACGCGCTTATGGAAGATCTACTTGAGGATACGG
AAGAGCCGTCTGCACCGGAAGCACCCGAGAAGGAGGAGATTACTGAGGTCATATCTACCACCACTGGGGATGGACGCCGC
CGTGGCAAGCGCCGTGTGATGCGAAAGAAGATGATTGAAGATGAAGGTGGCTACCTCGGTAAGTTGTCGTTATCGCCTAT
GCCAATGTCGATGTTCCATTACTGATCTCATTCAACAGTCACAATCCAGGAACCTGGCTGGGAATCTTTTTCCGAGGACG
AGGCACCACCTCCGAAGCCAGCTCAGCCAGCCAAGCCAGCCCAGAAGTCACACTCGACCACTCCAGCTGCCAAGGCGAAA
AAGCCGGCAGGACAAGGAAGCATCATGTCGTTCTTCTCCAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62