GenePrediction:GLEAN_7544 Details

Name: GLEAN_7544
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1386311..1384436 (- strand)
Length: 1876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1386311..1386181 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_140:1386096..1384886 (- strand)
Length: 1211
Type: CDS
Source: GLEAN
Position: GCSC_140:1384829..1384662 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:1384606..1384592 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1384530..1384436 (- strand)
Length: 95
>GLEAN_7544 class=GenePrediction position=GCSC_140:1386311..1384436 (- strand)
ATGGCGCCTCGACTGCTCTCATCCATCGCTCTGGCACTGCTTCTGCAGATACCGCTCACCGGCGCAAACCAGCAGAAGGT
CTTGAACTCGGATGCCTGTCCCGATTACGCAACCTACGCAGCCTACCCGCAGTAAGTCGAACCTGCAAGCCCAGTCTGCT
CCTCCCAACCCAAAGCTCTTGTGACCAGCCGGACTGACAGACGTCCTGCTCCCAGCCGACCGCTCAGCGAGGGCCCATTG
GCCCTTCCGTTTCAACGACCAGATAAGCGATGTCGCACGTTTCACTCCGATGCCATCGAGAAGGTCATTGAGGACGTGAC
GTCCCGCATGAAAGACGTTGATCTTGCCCGGCTCTTCGAGAACGCCTTCCCGTCGACGACCGACACGACGATCAAGTTCC
ACACGAACGGCGCCGACAAGCAGTCCAAGAGCAAGGGCCACGGCAAGATCGGTGAGAAGAATTGGGAGGGTCCGCAGTCG
TTTATCATCACGGGCGACATCGTGGCCGAGTGGCTGCGCGACTCGACCAATCAGCTGTCGCCCTACCAGCCGTTAGCCAA
GAAGGACCGCGCCGTGTTTGACCTGATCCTGGGAGCCATCAACACGCAGGCCGAGTACGTGATTGCGAGTCCGTACTGCA
ACGCCTTCCAGCCGCCGCCCATCTCGGGCCTGCATCCCAGCCACAACGGCCAGGACGACGTGGTGCATCCGACCTACGAG
CCTTCGGCCGTGTTCGAGTGCAAGTACGAGCTCGACAGCCTGGCCCACTTCTTGGCCTTGACAAACAACTTTTACGAGCA
CACCGGGTCGACCGACTTCATGACCCTTCGCTGGTTCCGTGCCGTCAACACCGTGCTCGAGGTGCTCGATCAGCAGTCCC
AGTCCACGTTTGACCCCGAATCCGGCCGCTTCGTCGGCAACCCGTACACCTTCCAGCGCCGGACAACCCTCGGCACCGAG
ACGCTCAATCTGCGCGGCATCGGCAACCCACTTAACAACGGCACCGGCCTTGTCCGCTCGGCCTTTCGCCCCAGCGACGA
CGCCACCATCCTCGGCTTCTTCATCCCGGCCAACGCCATGATGGCCGCCGAGCTAAAGCGCACCGCCGTCATGCTCAAAG
CTGCCCCTGGCCACTACAATGCGCTGTCTGACAAGGTCTCCGGCTGGGCCCAGAGCATTGCCAAGGGCGTCTGGGAGCAC
GGCGTGGTCAAGCACCGCGTGTTCGGCGACGTTTTTGCCTACGAGGTTGACGGTTACGGCTCGCACATCCTGATGGACGA
CGCCAACTACCCGTCGCTTCTGGCGCTGCCGCTAATGGGTTTCCTGTCTGCAGACGACCCAACCTACCGAAACACGCGAC
GGATGTTGCTGAGTAAGCAGACAAATCCGTACTACCTGACAGGCCACGACTTCAAGGGTATCGGAGGTACGTTTGCCGTC
TTCAGTTGCACTCTCTGTCGGCCGCCTCTAATCGCAGGTCAGGACCCCATATCGGCCTCATGAACGCCTGGCCCATGAGC
CTGCTTATGCAGGCGCGGACAACCGAGGACGACGCAGAAATCCAAGAATGTCTCTCCTTGGTACTCAACTCTGCCCGGCT
GGGCCTTATTCACGAAAGCGTCAGCGTGAACCATATCCCATCATACACACGTTCGTCCACCCTTTCCCCTGCTTGCTATA
TGAGTGATCACTAACATTCGGGCAGGGAGCTGGTTTGCATGTAAGTATACACTAGCAATCTGAAAAGCAGTCGCCCAATT
GCATATGCTGACATTTTCTAGGGGCGAACGGCGTCTTTGCAGAGACGATACTAGACCTTGCGAAGCGGAAGCCCCATTTG
ATTTTCAAGGCCCCGGCATTGCCTTACGAGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62