GenePrediction:GLEAN_7545 Details

Name: GLEAN_7545
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1381569..1380358 (- strand)
Length: 1212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1381569..1381567 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:1381488..1381412 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_140:1381203..1381008 (- strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:1380816..1380358 (- strand)
Length: 459
>GLEAN_7545 class=GenePrediction position=GCSC_140:1381569..1380358 (- strand)
ATGGTACGTTGCAGGCTCTGCTCGTCCGACCATCCAACCTCGAAAGATTTTCTGATCACTAACCTTCGCTCTCTATTCTA
GACATCCACATCTTCCACAGCTACACCTGGGAAGCTTGGCTTCGATGGTCGGGTGATTGCTGCTAAACCTCCCAAAAGGT
TTGTTTCTCTTCATTTACTCAACGTCGAATGCCAGTCTCGTCCGCAACGTGATGATTATATATTTGGGAATCTCTCTGAG
AATTATCATGCGGAGTAGACATACTTTTTTATAAAGCGGACTGATCTTGTTGATGGAACTGGCTTCACTGTTGCACCCGT
TCTTACAACGTGTAGAGTTGTGCATATTGCTAACATTATTTTGAAGCGATATCAACGCCTTGATACTCGACTATTTGACC
ATGGAGGGATATCCAAAGGCTGCGGCCCATTTCTCGAAAGAGGCCAACTTAAAGCCGCAGCAGCAGGACTCGTCCATCCG
GACGAGGCAGCAGATCCAAAATTTCATCCACATGGGAAAGATTGAGGAGGCAATTGTCGCACTCAATTACCTGAACCCAG
AGGTGAGACTTTCCTTCCTGCCTTTTTCCCTTCATCGCTATGATTAGACTCTGTTTCATGCACCACTCATATGGCCTATG
TGCCCTTGATGAGACACAAACCACACTGAAAATTATGAGCGACAAAAACTTCAATTATTGTTTTAAACTATCGTTTTGCA
AATTTGGCCCACAAGACTAACCCTTGTCTTCAGATCCTGGACCAAGATCCTCCACTCCATTTTGCACTTCTTCGGCTCCA
GCTGGTTGAACTCATTCGCAATTGTGATACGAGCGACATGCAGTCTGTCTTGGCGTTTGCAACAGATCAACTCGGAACAC
GCGCATCCACACGTCCTGAATTTCTTCGCGACCTGGAGGAGACGATGTCCTTGTTGTTCTTCGCACCAGACAAGCTACCA
CATGAGCTCAAGAAGCTGTTATCGCCAGACCTTCGGGAAGAAGTGGCTGACAAGGTCAACAAAGCCATTCTTCGCCACAA
CAGTTTGCCCAGTGAGGCAGCTATAAGACAGCTGGTCAAGATGAGGGCATGGGCCGAAGATGTGGCAAGAGTTCGTAAGA
ATGACATTCCCGTCCACATCGACCTCGGCCTGCAATCCACCGATAATGACAACATGCCGGAAAACGGGCACGAACCTATG
ATTACTACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62