GenePrediction:GLEAN_7546 Details

Name: GLEAN_7546
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1378673..1377902 (- strand)
Length: 772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1378673..1378626 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:1378559..1378545 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:1378315..1378165 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_140:1378066..1378001 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_140:1377927..1377902 (- strand)
Length: 26
>GLEAN_7546 class=GenePrediction position=GCSC_140:1378673..1377902 (- strand)
ATGAGCTACATCACTCGCCGAGCGCTTTCGACGCTCATCCCCCCCAAGGTGTGCTATGCCCGTCGCAGAGAAACCGAAAA
CTTTCAATTGTCGGCTACTAATTGAATTCCCTAGGTTGCGTCGCCCAAGGTACGTCGAGACCGAAGCGGTTGTTGGCCGT
TTCCGTGAAGTGGGATGGAATCGAAAACGCGCGACTTTTCCACCTTTGGCAAATTGCGAATGCCGAACCTGTAGAGGTTA
TCGAGCGATGCCTGCTTACCGCTGCTGCAAACGCTTTAGCACGGGCGAGGAAGGGAACATGCGCATTATGATGCGCCATT
TGGATTGTTCGGAATGCTGATATCGGGTCTCTGCACAGGCTATTGGCAGCGCTCCGGATGCTGTGCGCATGCAGCGTGTT
GTCAGCTTCTACGAGAAGCTTCCCCGTGGCCCGGCTCCCGAGGTCAAGGCCAAGGGCATTCTCGGTCGCTACCAGGCCAA
GCACTTTGGCAAGAACGCGACCGCGAAGCGTACGTCACATCGCTCTTCGTGCCGCGGGGTTCATCCTCTTGGTTCCCTGT
CGACATTGCAGCTTGCCTTGTCATGCTAACGTGTTCTTCTATTGCAGCCATCATCCAGGCCGTCGCTATTCTCGTCATCA
TCGGCTACGCCCAGCAGTACTACTTTCACCTGCGTAAGTAGTTAACGTGACAACTCAGTCGTTGCGGTTGATTTTGTTTG
CTAACAGCTTTCAATCATCTACTCAGGTCACCACAAGAACAACGCCCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62