GenePrediction:GLEAN_7547 Details

Name: GLEAN_7547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1376676..1372573 (- strand)
Length: 4104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1376676..1376611 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_140:1376342..1375841 (- strand)
Length: 502
Type: CDS
Source: GLEAN
Position: GCSC_140:1375784..1372573 (- strand)
Length: 3212
>GLEAN_7547 class=GenePrediction position=GCSC_140:1376676..1372573 (- strand)
ATGATGGCTGCTGAGATCCGTGACAGCACCATCGTTGAAGCTGCCGCTATATCTGACTCCAATGCTGTGAGTTTGATCTT
GCCTTGCGTTGCAAACGGCTCTTTTCCTCGACCCCGTGCCAAGACGAAAATGCCCTTCCCCCCCCCCCCCCCCCGCATAG
CTGTCTGCCTTACCCGTGGCCGCATAGTATACGCTAGGTCTATATTAAACCTCTGCCTCGTTCTATTTATGTACTGTCCT
GCTTGTGGCGTGCGCATTTTTAACTAGCGCATCACCAGGCATCCGTCGTGGATGTTTTATTTCTGTTGCCGGGCCTCGCT
AACGTGTTTTCCAGACCGCGAAGATCAACGACCAGCCCAACGATGTCGACTCCAGTACGCCTTCTCTAAAGGGCCCGGAC
TCTTCTACTTCCCCCGACGAGCTCGCAAACAAGCACATCGCCGATATCGTGGACGATCTGGTAAACTCGGCGGAACCTAG
CATCAGCGGGGGGTCAGATACCGAAACCTCCCGGTTAGACGCGCTGAGGGGCAAGAATGGAGATAACGGGCACGCTCGGG
CATCGTCGGCCGCTCGGAAGCCAGCCGTTTTCAAGGCCGTATCTGTTAACAAGACCTTCCTTGCAGCCAAGGCCACGGTG
CCCGGGGCGGCGAAACCGGGTGAGAAGGCCTCGCCGACCCTGGGCGTGGCCACGCTCAGCTCTAGCACTTCAGCTTCTGC
TCGCCCGCGGCTGATCGCCAAGACTGGTGGGGGCTTGGTTGCGAAGGGATCCGGCGGCACGAACGGGCGCCCTGCGGCGG
CACCGGATGCAAATGCTGTGTGGAACAAGAATAGGCGTAAGTCTATATATGATACAAGGACTATTGGCAGGCGATTGCTG
ATACCCAAACAGCGGTGCCGGTGCCTGAGCCGGCGAAGCTTACCGACGAGGAACTTAAGAAGTACGGCATCCATGTAGCC
TCACGGCTGCAGCAGGATGACGCGAAAGGTGAAGCAAACTGGGCAGATATTGATGACGACGACGACGACTGGGCTCCGGA
GGAAATACGCTGGACTGACGGCACCAAGTCGACGATCCCGCACCACGACGAGCACAGTCTGGCCTCACCACAGCCGGCCA
TGTCTGAGCTTGCGGTGCGACCGAGCTCTTCGCAACTGCATCCTCAGCCGACTCCCGTTGCTCTGCTGGTCAAGGAGGCC
GCACCGGTCGAAAAGCCGAAATCGCCCGCGCCGGTGTCGGACACCCCTTTCACGAAGCCATCCGGACTCCCGTCTGGCAA
GGGCCTCATCCTGAAGGGTGCCCAGGAGAGGCCGACACTGGTGGCAAAGCCGCCTGCTCCCCCGACACCGGTAAAGTCAC
CCTGGGCAGCTCTTCCTCCCATCGATAAGGCGCCACCGGTTGTGATGGAGCTGCCACACGGCGCAAATGTGGCACGGATG
CAGCACCACCAGCCGTACCAGCCACATCAGCAGAGAGAGAACTACGGTCCGCCTCCGAGCACGACGACACCACCGCCATT
CAAGGAGATCGCAGCAGACGACTTCAGTCGCGGCGGCTTTAGAGATGGCCATCCCCACGGGAATCGGGAGCTGTTCAACT
CGCAGTCCGGACGGCTCGAGCCGGTCCAAGACCGGCGAGGCGGTGTGCGTGGTGACGTGCACTACAGACAGACGCCGGGG
ACGATGCTGCTCCAACGGCCTTCGCAGATGTCGGATCAGCCGGAACCGTCGGCAGCGTTCCAGACCCATAGAGGCAGTAT
GCAGGATGCCGGACCGTACGGCAGACGTCGCGGCTCCTCGAACGTGAGCGGTGGGAGCGGGTTCTTGCAGCGACTCAGCC
GGACAGGCGACCAAGGCCCGGATCTCCTCAGTGCGAGACAGCCGTCGGTTACGGGCGAGAGCGACAGTCCGGCATCGCCG
AGGAACTTTTCTCCGTCAGGGTCTCGTTCGTGGCAGTCTCGTCCGTCACCCCGCTTGGCGTTTGCGGCACCATACAGCAA
TGCGCCGGCGGAATCTCTGCCATCAGCGCAGCCAACGGTACAGGGGCCGCCTCCTCTGGTCGTTACTGGGAGTCTTGACG
ACGAGATCGAGATGCAGAAGAAGATTATGCGTGAGCGGAGGGAGCTGGCCATGAAGAGACGTTTGGAGGAGGAGGAACGA
GAAGAGGCAGCTCGGAGAGAGCGAATCCGATTGAAGCTGGAAGCGCTGGGCCCGGCGCCGGAGAGGAAGAGCGCAAAGAA
GGAGGCAGCGAAGGAGGACACGACATCGTCTGTGGTCACGCCTGCGAGTGGTGCGCCTCCAGAGCCTAAGCACAATGCCA
GCCGCGATGCAGCCGGCGACAACGCGCAGTCATCGCATGCGACGAACGACAGCAATGCGGCATCACCCGGGACGAAACGG
CAACAGCAGTCGTGGCAGAGTCCAGCAGCACCCCCATCTGACCGGCTTTCGTCATGGGGCAGTGGAGGCCAGGCGCCGTC
TCGGAATCTCTGGGCTGCACCAAGCAGCAACCGAAGCCTCGGCAACGGGACATCGTTTGTCACGGAGCCATACGCACCGG
CGGTCTCTCAAATTACCAGCAAGCAAGGTCCTGGTCCCATCGGACCGCCTGCTTCACAGAAGAATGCAGGGCCACCAGCG
ATTACTCCCATCGGCCCCCCAAAGACGGCAACGGCGACAGGAGCAGCAGCTGCTGCACCAACAGTGGCGCAGCCGGCTGG
GCCCCCAAGCTCTGCCAGCTCGGCTCGGAGTGCGTGGACCAGCGCGGTCAAGGCGGGCGACGAGGATCTGCTGACGCAGC
AGAAGACGCGACGGGCAGAGCAGCAGCGGGAGGCAGAAGCTCGGGGCATGTCGCTTAACGATCTCCGGCCTTCGATCAAA
GACACGTGGTTGCCGACACGACTGAACGAGGACGGCGACCGGATCGAGGACAAGAACAAGCGGTCGGTTGTGCACCGAGC
GGGCAATACAGCAGCTCCGCCTGTCGGTTCGTCGGCGGCTCTTCCTCCACAGCAGCCGCGGCCGTCGAGATTCTTTCCGC
CACGGGATGCTCGTTCGGACGATGTGTCGACCGGGTCTGGAGCCACGGCCATGGGGGCTGGAGGAGGCCGACACGGTCGT
CCGGGCTCGCCGTCGCCACCACCGCCCGACATGGCCGGTCATCCGGTCTACGACGGCGATGCCGCCCATCCGCTTGTGTC
TCTTCCGCGGCCATCGATTGTGGTGCGCCTGCCTCCGGAGGACAAGGCTGCCGGAGCCGAGACGGCACAGCCGGCGACGA
CACGGAATGGCCAGCATGTGCAGCACGGCTCCCACGCCGGACCTTCACAGTCTTCCCAGTGGAAGCAACACTCGCCAGTG
GCCAAAGACGACAGCTCGTGGCAGGCGCGGTTCGACAACCTGTTCGACCGCAAGGCCACATCTCCGTCGAAGCCGTCGAT
GGGCAGAAACACAGGAGCAGACAGTATACCCCGAGGGCCGGCAGCCGAGACGATCGCAGCATCGCAGCGTCGCCCTGCTG
CTGCCTTGCCAAAAACACCTCTGGGCGGCTCGGATGCGAAGCCGGTGCCGGAGGAACCGATCAACTCGCGGTCCATGGCC
GAGGAGTGTTTTGAGAGACAGGAGATGGGCTCGCTGCCACTGGTCCATCTGCCTCACAAGGCTCCCGAGCTGGCCTGGAC
GCCAGCAGCAGCGCCCAAGCCGCTGCCCCGACGCTTTCTGCTGTCGGCCACCACGCGCGTCGACCATGACACCTTTCTCA
AGGACTCGTTTGGCGCGCCGTATGCCGTCAGCATCCGGATGCCGGGCGTGTCGGGCAGCGCCAAGGAAGTGCGTCTGCCG
ATGCCGAGGACGCCGAGCAACTCCCGCCGGTCGAACCACGGCCGTAGCGGACGGTCATCGCGAGGCACCAACCGAGGAGG
CCGGGACGCCGCTCCGACGCATCCCGGCTCCCACAACAACGACCAGAGCCAGCCGGCCAACGCAAACACGAACGTGAATG
CGAACGCGAACCACGGGCCGCCTGTAGGCCGGTCTCGTGGCGGCGGCCTGCGCCATCGTTCCGATAACTGGACCAGAAAC
TCGTCTGCTCCAGTCCAGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62