GenePrediction:GLEAN_7548 Details

Name: GLEAN_7548
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1367094..1366212 (- strand)
Length: 883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1367094..1366678 (- strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_140:1366619..1366212 (- strand)
Length: 408
>GLEAN_7548 class=GenePrediction position=GCSC_140:1367094..1366212 (- strand)
ATGGAAGCACTGCTCTCTCTCGCCTTTGACAACCTGTCGTCCTACGATGGACCCAAGATCAAGAAGGGCCTGAAGCAGGT
CGAGGGTCTCTTAGCACCCATTTGTCTGTCCGCATCGCGGTCCAAGAAGAGGCCGACCACCGAGGAGGAGCAGCAGCAGC
AGCAACAGCAGCGACCACCCTACAAGACACTCGACGACCTCAACGACGACCCAGCCTTCTTCGAGTTCTTCAAGCTGCAG
GAGGGCTTCGAGTGGAACATCGCCCAGCGGCTGCTGGACACGCTGGATCGACTGCTCTCGCGCGGCAGCGATGGTCAGAA
CGACATGCTGATCCTCAACACCTTGGATCTGACTCAAGGCATGCTTCTTCTGCACCCACCTAGCAAAGTGCTCTTCTCGC
GGGAAAAGTACATGAATGTGCGTCTAGCTCTCATTTTCTCTCCTCCCCCGTTTCATCCCCCGCTAACCCCCTCAGCTCCT
CCTCGATCTCCTCGAACCGGTCAACTGTCCGGCCATCCAATCGGCCACGCTCCTCACGCTCGTCGTCGCCCTCATCGACA
CGCCCCAGAACACCCGCGCCTTTGAGGCCCTCGACGGCCTGCTGACCGTCACATCCATCTTCAAGTCCCGGTCGACGTCG
CGCGAGGTCAAGCTCAAGCTCGTCGAGTTTCTCTACTTTTACCTCATGCCTGAGACGCCCTCGATTCCCTTGGCCAATCC
GCGCGACTCTGTTCCTGCACGCAAGCGACGCGGAAGTGCCGACGACGACTTTACGCGCACGACCGAAGAGAAGCAGGCTC
TTCTGGGACGTCACTTGCACAACGTCGACGACCTGGTCCGCGACCTCACAGCACATACGCCGTTTGGAGGTGCCGTGTGC
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62