GenePrediction:GLEAN_754 Details

Name: GLEAN_754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1883607..1884945 (+ strand)
Length: 1339
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1883607..1883612 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_97:1883907..1883975 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_97:1884154..1884171 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_97:1884254..1884784 (+ strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_97:1884853..1884945 (+ strand)
Length: 93
>GLEAN_754 class=GenePrediction position=GCSC_97:1883607..1884945 (+ strand)
ATGAAGGTGCGTTCATTCTCACAGCAGACCTTCGGTGCAAGTCCCCTTCGAATCCGAGTTTTGTGTCTCGCTCCTTCTTC
GACGACTGGACGGCACGACAACCTGGTATGACGGCTTCCAAATTTGCGATGGCACTGGATAGAATCGCCTGCGACGATCA
GAACGATATTGTCTACAATGGCCCTGCCACGAGAAATATACAGACGATCGCCACCCACGCCATTGGAGCTTGAAGACACG
GATTCGAACGGGGACCATGCGATGCTGTCTTGGGGATAGCCGTACTGACTTGGCTCGCAGTTGAACATTAGCAACCCGGC
CACCGGTGCCCAGAAGCTGATCGAGGTTGAGGATGAGCGCAAGCTGAGCGTATGTCTTGAACCCACCCCACTGGTTTTCT
CTCTTGTCTGTTGGCTGGCATTGGAATTGGATGGGCTGCAGGGCTGCACAAAATACATCTCTGCTGCAAACTCCAATTCC
ATTGCCTCCTCGCACTGAGGAGACAAATACCGAGCTTTTCGCAAATAGCTAACCGTCTTCCTTGCAGATCTTTATGGATC
GTCGGGTTAGTCAACTTCTGCACAACGAGGCCGGCCACGGCAGGCCGAAAATACCGAGATCTGTAAAACTGACGTCTGAT
GGTACAGATGGGAGCTGAGCTTTCGGCAGACGTTCTCGGCGACGAGTGGAAGGGCTACGTTGTCCGCATCACCGGTGGCA
ACGACAAGCAGGGATTCCCCATGAAGCAGGGCGTCCTCCAGCCCTCGCGTGTGCGCCTGCTGCTGTCTGACGGCCACTCG
TGCTACCGCATCCGCCGGTCTGGCGAGCGCAAGCGCAAGTCCGTCCGCGGCTGCATTGTCGGCTCCGACCTGTCCGTCCT
GGCCCTGGCCATCGTCAAGCAGGGCGAGGCCGACATCCCCGGCCTGACCGACGTCGTCCACCCCAAGCGCCTGGGCCCCA
AGCGTGCCCGCAAGATCCAGAAGTTCTTCGGCCTCACCAAGGAGGACGATGTCCGGAAATACGTCATTCGCCGCGAGGTC
CAGCCCAAGGGCGAGGGCAAGAAGGCCTACACCAAGGCCCCCAAGATCCAGCGCCTCATCACTCCCCAGCGTCTGCAGCA
CAAGCGCCACCTGATCGCCCTCAAGCGCCGCCAGCAGGAGAAGGTCAAGGACGAGGCGGTGAGTTTCCCTGCCCGCTCTG
CGCCCGCCCATCCTCTTGCCCTGCAGTCACTAATCCTTCTTCCCAGAACGAGTACGCCCAGATCCTGGCCAAGCGTGTGC
ACGAGGCAAAGGCCCAGAAGGCCGATCTGCGCAAGCGGCGCGCAAGCTCCCACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62